Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Double-promoter expression vector and construction method thereof

A dual promoter and expression vector technology, applied in the field of genetic engineering, can solve the problems of high cost and cumbersome operation steps

Pending Publication Date: 2020-05-01
XINXIANG MEDICAL UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this process is relatively cumbersome and expensive due to the

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double-promoter expression vector and construction method thereof
  • Double-promoter expression vector and construction method thereof
  • Double-promoter expression vector and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] In this example, the EGFP gene is used as the target gene and pIRES-neo is used as the starting vector as an example, and the construction process of the dual expression vector pIRES-CMV / T7-EGFP described in this application is introduced as follows.

[0052] (1) For the target gene EGFP, design primers and perform PCR amplification

[0053] Using the EGFP (Enhanced green fluorescent protein) gene (GenBank: U55763.1, 613-1329 bases) sequence in the pEGFP-C1 plasmid as the target gene, design primers P1 and P2 as follows:

[0054] P1: 5′-CCGGAATTCATGGTGAGCAAGGGCGAGGAG-3′, (the partial sequence of GAATTC at the 5′ end is the introduced Eco RI restriction site)

[0055] P2: 5′-CTAGGATCCCTTGTACAGCTCGTCCATGCCGA-3′; (the partial sequence of GGATCC at the 5′ end is the introduced BamHI restriction site)

[0056] The pEGFP-C1 plasmid was used as a template for PCR amplification (the size of the amplified product was 717 bp). After electrophoresis detection, the PCR amplificati...

Embodiment 2

[0091] In order to determine the expression of the target gene EGFP in eukaryotic cells or prokaryotic cells, the dual promoter expression vector pIRES-CMV / T7-EGFP recombinant plasmid constructed in Example 1 was further transfected into CHO-S cells and Transformation of Escherichia coli BL21, the specific experimental process is as follows.

[0092] (1) Expression vector transfection CHO cell expression system

[0093] CHO-S cells were pre-cultured in DMEM-F12 medium containing 10% fetal bovine serum and 1% penicillin / streptomycin, and the culture conditions were: 37°C, 5% CO 2 Cultured in an incubator, when the cell adherent growth density reached 90%, digested with 0.25% trypsin and collected the cells, 2 × 10 5 Seed each well in a 24-well plate, and use Lipo2000 (Lipofectamine® 2000) as the transfection reagent for transfection when the cell density reaches (about 24 hours) 60%-70%.

[0094] During the transfection process, the pIRES-EGFP vector (constructed in step (2) ...

Embodiment 3

[0108] On the basis of Example 2, in order to further investigate whether the dual-promoter vector constructed in this application is suitable for the expression of other target proteins, the inventor further used ASFVp54 as the target protein, taking this as an example to construct a recombinant dual-promoter vector pIRES- CMV / T7-p54 was translated and expressed using eukaryotic expression system and prokaryotic expression system respectively. The specific process is as follows.

[0109] The gene sequence (576bp) corresponding to the target protein ASFVp54 is as follows:

[0110] ATGGATTCTGAATTTTTTCAACCGGTTTATCCGCGGCATTATGGTGAGTGTTTGTCACCAGTCTCTACACCAAGCTTCTTCTCCACACATATGTATACTATTCTCATTGCTATCGTGGTCTTAGTCATTATTATCATCGTTCTAATTTATCTATTTTCTTCAAGAAAGAAAAAAGCTGCTGCCGCTATTGAAGAGGAAGATATACAGTTTATAAATCCTTATCAAGATCAGCAGTGGGTAGAGGTCACTCCACAACCAGGTACCTCTAAACCGGCTGGAGTGACTACAGCAAGTGTAGGCAAGCCAGTCACGGGCAGGCCGGCAACAAACAGACCAGTTACGGACAGGCTAGTCATGGTAACTGGCGGGCCAGCGGCCGCAAGTGCGGCCGCAAGTGCGGCTGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
fluorescenceaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a double-promoter expression vector capable of simultaneously expressing target genes in prokaryotic and mammalian cells and a construction method of the double-promoter expression vector. The vector takes a eukaryotic expression vector as a starting vector, and a genome contains a prokaryotic promoterT7 sequence, a ribosome binding site and a T7 termination sequence. The constructed double-promoter expression vector can simultaneously express the same target gene in the prokaryotic and eukaryoticcells, can overcome the defect that steps are complicated as the existing same target protein needs two expression systems in the mammalian and prokaryotic cells, and also lays a certain technical foundation for expression of related target genes in different expression systems.

Description

technical field [0001] This application belongs to the technical field of genetic engineering, and specifically relates to a dual-promoter expression vector capable of simultaneously expressing target genes in prokaryotic and mammalian cells and a patent application for its construction method. Background technique [0002] In the routine application of genetic engineering technology, the artificially obtained exogenous target gene is recombined with the vector in vitro, and then the recombinant vector is introduced into the recipient cell and the target gene is normally replicated, transcribed and translated in the recipient cell. , and in-depth analysis and research on the function of the target gene can be carried out. Based on this principle, genetic engineering technology has been widely used in the field of medicine, such as the production of recombinant protein drugs, gene therapy and so on. [0003] In the prior art, when genetic engineering is used for the producti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/85
CPCC12N15/70C12N15/85C12N2800/107C12N2830/008
Inventor 王小引王天云易丹丹许重洁苗馨之张伟莉杨雯雯
Owner XINXIANG MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com