A genetically engineered nitrilase modified by site-directed mutagenesis
A technology of genetically engineering nitrile and nitrilase, which is applied in the field of genetically engineered fungal nitrilase, can solve the problem of few applications, and achieve the effect of high catalytic activity and low amide generating ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0024] The invention uses the fungal nitrilase gene sequence derived from gibberella as a reference, designs and synthesizes two oligonucleotide primers, adopts unmutated recombinant plasmids, and amplifies mutant plasmids by reverse PCR.
[0025] The two oligonucleotide primers are as follows:
[0026] Forward primer: TACGGTGACGGACAGGGCTCTCTGA
[0027] Reverse primer: ATTGGTCAGAGAGCCCTGTCCGTCAC
[0028] The PCR reaction system is:
[0029] Pfu enzyme 0.5 μL 10×buffer 5 μL Template DNA 1 μL f 2 o 38.5 μL dNTP 3 μL Forward primer 1 μL reverse primer 1 μL Total 50 μL
[0030] The PCR program conditions were set as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 8 min, 35 cycles; final extension at 72°C for 60 min.
[0031] The amplified PCR products were subjected to 1% agarose gel electrophoresis, and the target fragments were recove...
Embodiment 2
[0033] The PCR product obtained from the recovery of rubber tapping was used Dpn Restriction endonuclease I was used for digestion and digestion, and the digestion conditions were: warm bath at 37°C for 0.5h. The enzyme digestion reaction system is as follows:
[0034] Dpn I 1 μL 10×buffer 2 μL dna 10 μL dd H 2 o 7 μL Total 20μL
[0035]The digested products were detected by agarose gel electrophoresis, and the remaining products were used in subsequent experiments.
Embodiment 3
[0037] The deactivated PCR product was transformed into Escherichia coli by heat shock at 42°C for 90s E. coli DH5α competent cells, coated with Kan + Resistance (10mg / L) solid LB plate, cultured at 37°C for 10~12h. Pick a single colony, insert it into LB liquid medium for culture, extract the plasmid, carry out enzyme digestion and PCR verification. The plasmids of positive clones were selected and sent to Shanghai Sangon for sequencing. Those with correct sequencing results were transformed into Escherichia coli by heat shocking at 42°C for 90s E. coli Rosetta-gami (DE3) competent cells, containing Kan + (10mg / L) and chloramphenicol (35mg / L) resistant LB plates were cultured overnight at 37°C, and positive transformants were selected, which were genetically engineered nitrilase-producing bacteria.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com