Long non-coding RNA (Ribonucleic Acid) and applications thereof
A nucleic acid molecule and molecular technology, applied in the field of biomedicine, can solve the problem that IncRNA is in its infancy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1. Acquisition and identification of full-length cDNA of long non-coding RNA Yiya
[0069] 1. Nucleic acid sequence (SEQ ID No1) of Yiya gene:
[0070]5’-TTTGGGATGGAGGAAGTGAGGGAGAAGTGCTTCAGAGGTGGCAGCAATGTGCTTCTGAGCGTGGCTGCGTGGCTCCCTATTTCAATCTGCCTGTGAAGATTTCCTGAGGCATATGACCCTTCCTGCCATGACCCTTGGTTTCCAGAGGCATCTGCTGGTCAGCCCCTAGGCAACACTTAAATAGGAAAACTTTTGCCTATCTGTTACTAAGACATGCTGATTTCCAGATATCTTAGTACCCTTTTTATTATCTCTCTGCCTGGGGTTTAATAACAGTTAAAAGAGACAATTCATGCAATGTGCAACAAAGTTTACTTTGTGTACATATATTTGCTCTGCACATACCTGGCATATAGTAACTGCTCAATAAATATCAGTGGCTATTATAATCTAGAGCTTGTTGGGGAGTTGTCTGAGTGAGAAAAGAACAAAAGATACTCGTTTTACAAACAATTTTTGCTTCATCTCTGGATGGCATATTCATTTCTGAAGCATCTTCACACTCAGTTGCTAAGAATAGGATATATTCTTTCCATTGTACAGATGGAGTAACCGAGAGACTGGAAAGTGACATCACCAACAGGCGGTGACCTAGGGAGTCAGGGCCAGAACCAGGTCTGGAATACAGACTTCCTGACTCCTGACCCAGGTTCCCTTCTGCCCTGTGGCCTTCACAGGACGCCTGGAGAGACCAGGGAAGTATCTGTTTCAGGGCTCTCTGAGTTGCCCTTGGAAGTTTATCATCTATCAACTGACTGTTGACCAAAAACACACTGATTCCTGAGGAGACCTTACAGGATGTCCTGTTGAGACTTTTCCTCCTC...
Embodiment 2
[0079] Example 2. Northern hybridization detection of Yiya expression difference in tumor and normal tissues
[0080] 1. Yiya hybridization probe sequence (SEQ ID No6)
[0081] 5’-ATCACTTCTCATCTAGATTCCCATTTTGGCTTTGTCATCTTCTCCCACTACATTCCAGCTATGTAGTCCTTCATATAGTTTCTAGAACGTGCCAAGATTTCTCTTCTAGATCTTTGCATTTGAAATTCCCTTTGCTTATAATGCTCTTGCCTAGCTCTTCATATATCTGGCTTGAGGGCATCTCTTAAGAGAGGACTTCGACTTCACCAATCTGAAACAGCACCATGTCAC
[0082] 2. Northern hybridization to detect the expression of Yiya in tumor samples
[0083] 1) Extraction of total RNA from tissue samples: Weigh 1 gram each of 8 pairs of human tumor tissues and adjacent normal tissue samples (including liver cancer, esophageal cancer, ovarian cancer, and breast cancer) separated by surgery, and use NORGEN’s animal tissue RNA purification reagent The total RNA was extracted by the box; 20 μg of total RNA was denatured with formaldehyde, loaded onto 1% formaldehyde-denatured agarose gel, and electrophoresed under the conditions of 100V ...
Embodiment 3
[0089] Example 3. Subcellular localization of Yiya transcripts
[0090] Make the 5×10 a day in advance 5 HEK293 cells were planted in a cell culture dish with a diameter of 10 cm at an appropriate density. When the cells grew to about 75% of the density, the cells were collected; the medium was exhausted and washed twice with 2 ml of pre-cooled PBS; 5ml of pre-cooled PBS, scrape the cells with a cell knife, and inhale into a 15ml centrifuge tube; centrifuge at 1850g for 10 minutes at 4°C, discard the supernatant; add 5 times the volume of the cell sedimentation hypotonic buffer to resuspend, and wash the cells; 4 Centrifuge at 1850g for 5 minutes at ℃, discard the supernatant; resuspend the cells in hypotonic buffer twice the volume of the cell pellet, and let stand on ice for 10 minutes; slowly homogenize 30-40 times with a Dounce homogenizer; 4℃, 3300g Centrifuge for 15 minutes, discard the supernatant, and the collected pellet is the nucleus. (Freshly prepared hypotonic b...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


