Unlock instant, AI-driven research and patent intelligence for your innovation.

Wheat artificial micromolecule RNA expression vector as well as construction method and application thereof

A technology of expression vector and binary expression vector, applied in the fields of molecular biology and genetic engineering

Active Publication Date: 2013-09-18
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are several different methods for constructing artificial microRNA expression vectors, all of which focus on the operation of cloning the miRNA precursor sequence and linking it to the vector. How to obtain highly expressed amiRNA vectors, especially the application of artificial miRNA technology The complex genome of wheat has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat artificial micromolecule RNA expression vector as well as construction method and application thereof
  • Wheat artificial micromolecule RNA expression vector as well as construction method and application thereof
  • Wheat artificial micromolecule RNA expression vector as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Using the wheat tae-miR171 precursor sequence as the backbone sequence to construct an amiRNA expression vector that interferes with the wheat phytoene dehydrogenase (PDS) gene and its efficiency detection

[0046] According to the pairing characteristics of miRNA and miRNA* when the precursor sequence of tae-miR171 forms a secondary structure, search for sites that meet these conditions in the pds gene coding sequence, and obtain two relatively good sites as target sites after comparison analysis Points: (1) TGGCTTAAGGAATAAAGTAAA, (2) GTTGTTTGCCAAGATTTTCCA, forming an amiRNA corresponding to this site, which basically meets the characteristics of tae-MIR171, such as the first base is U, at the 4th, 9th and 12th positions Bases and miRNA* form mismatches and other characteristics, and the obtained amiRNA precursor sequence has a secondary structure similar to natural tae-MIR171.

[0047] Using the amiR171 precursor sequence containing the designed amiRNA and a...

Embodiment 2

[0073] Example 2 Using the wheat tae-miR171 precursor sequence as the backbone sequence, constructing an amiRNA expression vector and efficiency detection of the RNA polymerase 1 (RNA-dependent RNA-polymerase1, RDR1) gene that interferes with wheat yellow dwarf virus RNA

[0074] According to the pairing characteristics of miRNA and miRNA* when the precursor sequence of tae-miR171 forms a secondary structure, the sites that meet these conditions were found in the coding sequence of the rdr1 gene, and two relatively good sites were obtained as target sites after comparison and analysis Points: (1) CAGCTTTACAGAGGTCAAGAA, (2) CCGTCTCAGATTGGTGAAGGA, forming an amiRNA corresponding to this site, which basically satisfies the characteristics of tae-MIR171, such as the first base is U, at the 4th, 9th and 12th positions Bases and miRNA* form mismatches and other characteristics, and the obtained amiRNA precursor sequence has a secondary structure similar to natural tae-MIR171.

[007...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an efficient wheat artificial micromolecule RNA expression vector as well as a construction method and an application thereof. A wheat miR171 precursor sequence is selected as a skeleton sequence, an amiRNA sequence is designed for a proper target site on a specific target gene according to the matching characteristics of miRNA and miRNA*, and the amiRNA sequence is constructed to an expression vector for plant transformation so as to be efficiently expressed in the wheat, the efficient and specific amiRNA is quickly designed in the complicated heterologous hexaploid genome of the wheat for a plurality of homologous copies of a gene or a single copy of any gene so as to regulate and control the expression level of the target gene, which has important value in wheat target trait improvement and candidate gene function verification, and the like.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and genetic engineering, and in particular relates to a wheat artificial small molecule RNA expression vector, its construction method and application. Background technique [0002] MiRNA is a class of endogenous small molecule RNA. In plants, it mainly recognizes the target site through base complementation, cleaves or inhibits the target mRNA, thereby inhibiting the expression of the target gene. [0003] Artificial miRNA (artificial miRNA, amiRNA) technology is a new RNA interference (RNA interference, RNAi) technology that has emerged in recent years based on miRNA research. It is achieved by replacing the miRNA / miRNA* sequence in the miRNA precursor. Regulation of specific target genes has become a new tool for functional genomics research. As soon as the artificial miRNA technology appeared, it showed its strong vitality, especially in terms of specificity and stability. In for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82
Inventor 毛龙李爱丽武亮刘栋峰
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI