ROS1 fusion gene screening method
A technology that combines genes and screening, applied in the fields of medicine and biology, can solve problems such as extremely high technical requirements for operators, inability to effectively detect, and complicated experimental steps, and achieve intuitive result judgment, high scientific research and clinical use value , the effect of simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Embodiment 1 real-time fluorescent quantitative double-labeled probe PCR method
[0031] 1. Extract the total RNA in the sample and convert it into cDNA.
[0032] 2. Primer and probe design
[0033] Primer pair I
[0034] Upstream primer: AACATAAGTGGAACCATGCTG (SEQ ID NO 1)
[0035] Downstream primer: GCCATGATAAATGGTGGTTCA (SEQ ID NO 2)
[0036] Primer pair II
[0037] Upstream primer: AAGAAGATGGGCTTTGGAGTA (SEQ ID NO 3)
[0038] Downstream primer: TGAGATATCCGTCCCATTCAG (SEQ ID NO 4)
[0039] Primer pair III
[0040] Upstream primer: CTACTGGGCTGGAAAGACATA (SEQ ID NO 5)
[0041] Downstream primer: TAGAGTGTGGTCCAGTAGAGA (SEQ ID NO 6)
[0042] Primer pair IV
[0043] Upstream primer: GAATGACATGGTGGTGGATTC (SEQ ID NO 7)
[0044] Downstream primer: CCCATCACTGAGGTCTAAAGT (SEQ ID NO 8)
[0045] Primer pair V
[0046] Upstream primer: GTTGGTTCAAGACAGTCAATG (SEQ ID NO 9)
[0047] Downstream primer: TCCTAAAAGCCATTGATCCAGA (SEQ ID NO 10)
[0048] Primer pair VI
[0...
Embodiment 2
[0074] Example 2 In vitro sample screening
[0075] In vitro samples for screening were taken by conventional methods. This method was used to screen in vitro samples containing ROS1 fusion gene in 154 cases of lung adenocarcinoma without related oncogene mutations (EGFR, KRAS, BRAF, HER2, ALK fusion and RET fusion) (taken from the Cancer Hospital Affiliated to Fudan University In vitro samples), the results showed that 12 cases of lung adenocarcinoma with ROS1 fusion gene mutation were screened out, and the remaining 142 cases had no ROS1 fusion gene mutation.
[0076] In order to further verify the accuracy of the method of the present invention, ordinary PCR was carried out on 12 cases of lung adenocarcinoma screened with ROS1 fusion gene mutation and 42 cases of lung adenocarcinoma without ROS1 fusion gene mutation, and the PCR products were directly sequenced , the sequencing results were combined with software reading and manual checking, and the results showed that the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 