Unlock instant, AI-driven research and patent intelligence for your innovation.

ROS1 fusion gene screening method

A technology that combines genes and screening, applied in the fields of medicine and biology, can solve problems such as extremely high technical requirements for operators, inability to effectively detect, and complicated experimental steps, and achieve intuitive result judgment, high scientific research and clinical use value , the effect of simple operation

Inactive Publication Date: 2013-10-16
FUDAN UNIV SHANGHAI CANCER CENT
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Clinical practice shows that the common PCR screening method currently described has the following obvious defects: since there are more than 7 specific forms of the ROS1 fusion gene reported at present, it is necessary to design at least 7 pairs of PCR primers for 7 times respectively PCR reaction, which is time-consuming and laborious; moreover, if the sample is a new ROS1 fusion form (with an unknown "partner gene"), it cannot be effectively detected using this method, and false negative results occur
For fluorescence in situ hybridization (FISH), although it is currently considered the gold standard for diagnosing fusion genes, its high price, complicated experimental steps, and extremely high requirements on the technical level of operators make it impossible to promote it

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ROS1 fusion gene screening method
  • ROS1 fusion gene screening method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1 real-time fluorescent quantitative double-labeled probe PCR method

[0031] 1. Extract the total RNA in the sample and convert it into cDNA.

[0032] 2. Primer and probe design

[0033] Primer pair I

[0034] Upstream primer: AACATAAGTGGAACCATGCTG (SEQ ID NO 1)

[0035] Downstream primer: GCCATGATAAATGGTGGTTCA (SEQ ID NO 2)

[0036] Primer pair II

[0037] Upstream primer: AAGAAGATGGGCTTTGGAGTA (SEQ ID NO 3)

[0038] Downstream primer: TGAGATATCCGTCCCATTCAG (SEQ ID NO 4)

[0039] Primer pair III

[0040] Upstream primer: CTACTGGGCTGGAAAGACATA (SEQ ID NO 5)

[0041] Downstream primer: TAGAGTGTGGTCCAGTAGAGA (SEQ ID NO 6)

[0042] Primer pair IV

[0043] Upstream primer: GAATGACATGGTGGTGGATTC (SEQ ID NO 7)

[0044] Downstream primer: CCCATCACTGAGGTCTAAAGT (SEQ ID NO 8)

[0045] Primer pair V

[0046] Upstream primer: GTTGGTTCAAGACAGTCAATG (SEQ ID NO 9)

[0047] Downstream primer: TCCTAAAAGCCATTGATCCAGA (SEQ ID NO 10)

[0048] Primer pair VI

[0...

Embodiment 2

[0074] Example 2 In vitro sample screening

[0075] In vitro samples for screening were taken by conventional methods. This method was used to screen in vitro samples containing ROS1 fusion gene in 154 cases of lung adenocarcinoma without related oncogene mutations (EGFR, KRAS, BRAF, HER2, ALK fusion and RET fusion) (taken from the Cancer Hospital Affiliated to Fudan University In vitro samples), the results showed that 12 cases of lung adenocarcinoma with ROS1 fusion gene mutation were screened out, and the remaining 142 cases had no ROS1 fusion gene mutation.

[0076] In order to further verify the accuracy of the method of the present invention, ordinary PCR was carried out on 12 cases of lung adenocarcinoma screened with ROS1 fusion gene mutation and 42 cases of lung adenocarcinoma without ROS1 fusion gene mutation, and the PCR products were directly sequenced , the sequencing results were combined with software reading and manual checking, and the results showed that the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical fields of medicines and the biology, relates to an ROS1 fusion gene screening method, and especially relates to an ROS1 fusion gene screening multi-fragment primer and its application. The ROS1 fusion gene screening method comprises the following steps: adding real-time PCR combined primers having nucleotide coding sequences represented by SEQ ID NO 1-22 to a template which is the cDNA obtained through the inverse transcription of the total RNA of a sample, carrying out a real-time fluorescent polymerase chain reaction, and detecting a difference between the Ct values of reaction units in reaction products to examine whether there is ROS1 fusion gene mutation. The method has the characteristics of simple operation, time saving, visual and clear result determination, low cost and reduced pollution.

Description

technical field [0001] The invention belongs to the field of medicine and biotechnology, and relates to a screening method for ROS1 fusion gene, in particular to a multi-segment primer for screening ROS1 fusion gene and application thereof. Background technique [0002] ROS1 fusion gene is an oncogene mutation with important potential clinical therapeutic value discovered in recent years in lung cancer. It is currently reported that the ROS1 gene can be broken between exons 32-35, and the 3' stump of the ROS1 gene after the break can be fused with various "partner genes" such as CD74, SDC4, TPM3, SLC34A2, EZR, LRIG3, and GOPC , form the "ROS1 fusion gene", and produce the corresponding fusion protein. [0003] Studies have shown that the ROS1 fusion gene is found in about 1.7% of non-small cell lung cancers, and has been proved to be the "driver mutation" that causes the development of these tumors. The currently reported ROS1 fusion gene is only found in lung adenocarcino...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 陈海泉孙艺华王瑞潘云建胡海川王磊叶挺罗晓阳李航张扬
Owner FUDAN UNIV SHANGHAI CANCER CENT