Sugarcane genome endogenous reference gene fructose-6-phosphate 2-kinase gene PCR (polymerase chain reaction) primer sequences and amplification method
An internal standard gene and primer sequence technology, applied in recombinant DNA technology, DNA/RNA fragments, DNA preparation, etc., can solve the problem of no research report on copy number, and achieve the effect of easy determination, wide applicability and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] (1) PCR amplification of sugarcane fructose-6-phosphate 2-kinase gene
[0022] Fructose-6-phosphate 2-kinase gene PCR primer sequence is: ScF2KP -F:CCTGGGAGGATTGTCTTCTTC; ScF2KP -R: ATCACCACCGATTCTTCCTCT.
[0023] PCR reaction system: 1.0 U Taq DNA polymerase, 1×PCR buffer solution, 0.25 mM dNTP, 3.0 mM MgCl 2 , primer ScF2KP -F and ScF2KP Each of -R was 0.25 mM, DNA template was 25 ng, and the total volume of the reaction system was 25 μl.
[0024] PCR amplification conditions: pre-denaturation at 95°C for 6 min; denaturation at 94°C for 30 s; annealing at 56°C for 30 s, extension at 72°C for 35 s, a total of 35 cycles, and a final extension at 72°C for 7 min.
[0025] (2) Electrophoresis detection of PCR product of sugarcane fructose-6-phosphate 2-kinase gene and verification of product specificity and universality
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 