Multi-module DNA (deoxyribonucleic acid) library and method for constructing transcription activator like effector nuclease plasmid
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A transcription activation and effector technology, applied in the field of genetic engineering, can solve the problems of material cost, time cost, high sequencing cost, unfavorable TALEN specificity, cumbersome operation, etc.
Active Publication Date: 2014-04-02
上海煦顼技术有限公司
View PDF3 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
But they all have their own defects, because the chemical synthesis of highly repetitive sequences of DNA to be synthesized is very difficult and the cost is very high; the two-step method requires two steps of connection, so the material cost, time cost, and sequencing cost are all high; the now public The only method that can be connected in one step can only connect up to 14 recognition modules, and the length of common recognition modules in nature is 12-23. The limitation not only affects the application of this method, but also is not conducive to the
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0071] Example 1 Connection between TALENs recognition modules and construction of recombinant vector
[0072] In a preferred mode of the present invention, n=12, m=7, p=4; in the multi-module unit library, the number of double-base linking units is 12, which are divided into two groups, numbered 1-4 and 6-13 , the base sequences of the first cohesive end and the second cohesive end are respectively shown in the 9th-12th bases of SEQ ID No.45-52 and SEQ ID No.55-70. There are 7 single-base linking units in each group, and the coded amino acid sequences are, for example, the base sequences of the first sticky end and the second sticky end of the single-base linking units numbered 1 to 7, respectively, such as SEQ ID No.45-58 Bases 9-12 are indicated. The first sticky end of the single-base linking unit numbered 5 is complementary to the second sticky end of the double-base linking unit numbered 4, and the second sticky end is complementary to the first sticky end of the double...
Embodiment 2
[0143] Ligate TALENs that recognize the following bases.
[0144] Fragment 1: CGCGCGCGCGCGCGCGCGCGCGCGCT,
[0145] Fragment 2: CGCGCGCGCGCGCGCGCGCGCGCT,
[0146] Fragment 3: CCCACTCGTCCCATCCAGTA;
[0147] (1) First select the required recognition module from the PCR library:
[0148] CGCGCGCGCGCGCGCGCGCGCGCGCGCT selection modules CG-1, CG-2, CG-3, CG-4, C-5, GC-6, GC-7, GC-8, GC-9, GC-10, GC-11, GC-12 , GC-13; the connection vector is pEF1a-NLS-TALE backbone-Fok1(R)–pA (with a T recognition module on the vector).
[0149] CGCGCGCGCGCGCGCGCGCGCGCT selection modules C-1, G-2, C-3, G-4, C-5, GC-6, GC-7, GC-8, GC-9, GC-10, GC-11, GC-12 , GC-13. The connection vector is pEF1a-NLS-TALE backbone-Fok1(R)-pA (with a T recognition module on the vector).
[0150] CCCACTCGTCCCATCCAGTA select modules C-1, C-2, C-3, A-4, C-5, T-6, C-7, GT-8, CC-9, CA-10, TC-11, CA-12 , GT-13. The connection vector is pEF1a-NLS-TALE backbone-Fok1(R)-pA (with an A recognition module on the vector).
...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a DNA (deoxyribonucleic acid) library and a method for constructing a transcription activator like effector nuclease plasmid. A transcription activator like effector connection unit library comprises 16 groups*n double-basic group identification modules and 4 groups*m single-basic group identification modules, wherein two tail ends of each double-basic group identification module or single-basic group identification module are both formed into a first cohesive tail end and a second cohesive tail end by being subjected to enzyme digestion through a second class restriction enzyme; n expresses the quantity of each group of double-basic group identification modules, and m expresses the quantity of each group of single-basic group identification modules. The DNA library comprises plasmids, wherein the plasmids are the same as the connection units of the Tale connection unit library in quantity, each plasmid comprises a connection unit with basic group sequences mutually different, the connecting positions of the two tail ends of the connection unit and an original carrier are provided with BsaI enzyme digestion sites. The DNA library disclosed by the invention is used for constructing the transcription activator like effector nuclease plasmid, can realize that 19-26 identification modules are connected for one step by identifying the enzyme digestion of the modules and connecting in same reaction, and has the advantages of high speed, high efficiency, easiness for operation, easiness for material preservation and low cost.
Description
technical field [0001] The invention relates to the field of genetic engineering, in particular to a TALE junction unit library, a DNA library comprising all TALE junction units in the TALE junction unit library, and a method for constructing a transcription activator-like effector nuclease plasmid. Background technique [0002] It has always been the dream of many scientists to modify the genome according to human wishes. Specifically delete or add the sequences we need on the endogenous genome. On the one hand, various animal models can be constructed for basic biological research and disease mechanism research. On the other hand, animal reactors can be produced to produce what we need cheaply. Biological components that are difficult to obtain from other sources. People have not found a simple and efficient method for genome-targeted modification of the genome. Traditional gene targeting technology relies on the random exchange of homologous chromosomes naturally occurr...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more