Check patentability & draft patents in minutes with Patsnap Eureka AI!

LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method

A technology for detection kits and detection primers, applied in the field of molecular biology, can solve problems such as detection methods and kits for the cry2Ab gene that do not yet exist, and achieve the effects of simple operation, high sensitivity, and strong specificity

Inactive Publication Date: 2014-05-07
JILIN ACAD OF AGRI SCI
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no LAMP method has been used to detect genetically modified crops. cry2Ab Gene detection methods and kits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method
  • LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method
  • LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 A kit without a chromogenic agent and its detection method.

[0044] Prepared according to the following recipe cry2Ab Gene LAMP Detection Kit:

[0045] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare primer dry powder with sterilized deionized water at a concentration of 200 μmol / L. Mother solution, then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab Gene LAMP detection primer solution, wherein the primer sequences are:

[0046] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);

[0047] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);

[0048] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);

[0049] Internal primer 2: GACGTGATCCTCAACGCTGACG-TCTTCAGGTAGT...

Embodiment 2

[0064] Example 2 A kit containing a chromogenic agent and its detection method.

[0065] Prepared according to the following recipe cry2Ab Gene LAMP Detection Kit:

[0066] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare primer dry powder with sterilized deionized water at a concentration of 200 μmol / L. Mother solution, then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab Gene LAMP detection primer solution, wherein the primer sequences are:

[0067] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);

[0068] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);

[0069] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);

[0070] Internal primer 2: GACGTGATCCTCAACGCTGACG-TCTTCAGGT...

Embodiment 3

[0086] Example 3 Specificity experiments of kits and detection methods.

[0087]Experiments were carried out on the specificity of the kit described in Example 1 and its detection method, and the test samples included: cry1A.105 and cry2Ab Genetic corn MON89034, transgenic cry1Ab Genetic maize MON810, Bt11, Bt176, transgenic cry1Ac Genetic cotton MON531, transgenic cry1Ac and cry2Ab Genetic cotton MON15985, trans cry1Ab Genetic rice KF-6, transgenic cry1Ab / Ac Genetic rice TT51-1, transgenic cry3Bb Genetic corn MON863, MON88017, transgenic cry3A Corn MIR604, transfer cry1F Corn TC1507, transfer cry34Ab and cry35Ab Genetic corn 59122 and other 13 insect-resistant genetically modified crops, as well as non-genetically modified crops.

[0088] In this example, only the cry2Ab The LAMP amplification products of transgenic corn MON89034 and transgenic cotton MON15985 of the gene have typical amplification curves, while other transgenic crops have typical ampli...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP detection primer group of a cry2Ab gene in a transgenic crop and a detection kit as well as a detection method. The LAMP detection primer group comprises six specific primers, and the nucleotide sequences of the specific primers are as shown in SEQ ID NO: 1-6. The detection kit comprises a primer solution, DNA (deoxyribonucleic acid) polymerase with strand displacement activity, 10* reaction buffer liquid, dNTPs solution, positive DNA control and negative DNA control and can aslo contain a color developing agent. The detection method is characterized in that methods of using the specific primers and the DNA polymerase with the strand displacement activity for amplifying a sample DNA template at the temperature of 63-65 DEG C, adding the color developing agent to observe change in color or directly observe change in turbidity of precipitants in a reaction tube and the like are used for judging whether a sample contains the cry2Ab gene. The method does not need special instruments and has the characteristics of fastness, high efficiency, simplicity and convenience to operate, strong specificity, high sensitivity and the like and is suitable for field test.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method for transgenic plants and their products, in particular to a rapid detection method for transgenic crops using loop-mediated isothermal amplification technology (LAMP). cry2Ab Primer sets, kits and assays for genes. Background technique [0002] According to the statistics of the International Service for the Application of Agricultural Biotechnology (ISAAA), in 2012, the planting area of ​​transgenic crops in the world reached 170.3 million hectares, an increase of 100 times compared with 1996. This growth rate makes transgenic technology the most rapidly applied crop technology in the history of modern agriculture. . The types of genetically modified crops currently planted mainly include soybean, corn, cotton, rape, tomato, papaya, sugar beet, alfalfa, etc., and the target traits are mainly insect resistance, herbicide resistance or compound traits ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q2531/119
Inventor 李飞武闫伟龙丽坤李葱葱张明邢珍娟董立明
Owner JILIN ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More