LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method
A technology for detection kits and detection primers, applied in the field of molecular biology, can solve problems such as detection methods and kits for the cry2Ab gene that do not yet exist, and achieve the effects of simple operation, high sensitivity, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 A kit without a chromogenic agent and its detection method.
[0044] Prepared according to the following recipe cry2Ab Gene LAMP Detection Kit:
[0045] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare primer dry powder with sterilized deionized water at a concentration of 200 μmol / L. Mother solution, then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab Gene LAMP detection primer solution, wherein the primer sequences are:
[0046] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);
[0047] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);
[0048] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);
[0049] Internal primer 2: GACGTGATCCTCAACGCTGACG-TCTTCAGGTAGT...
Embodiment 2
[0064] Example 2 A kit containing a chromogenic agent and its detection method.
[0065] Prepared according to the following recipe cry2Ab Gene LAMP Detection Kit:
[0066] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare primer dry powder with sterilized deionized water at a concentration of 200 μmol / L. Mother solution, then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab Gene LAMP detection primer solution, wherein the primer sequences are:
[0067] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);
[0068] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);
[0069] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);
[0070] Internal primer 2: GACGTGATCCTCAACGCTGACG-TCTTCAGGT...
Embodiment 3
[0086] Example 3 Specificity experiments of kits and detection methods.
[0087]Experiments were carried out on the specificity of the kit described in Example 1 and its detection method, and the test samples included: cry1A.105 and cry2Ab Genetic corn MON89034, transgenic cry1Ab Genetic maize MON810, Bt11, Bt176, transgenic cry1Ac Genetic cotton MON531, transgenic cry1Ac and cry2Ab Genetic cotton MON15985, trans cry1Ab Genetic rice KF-6, transgenic cry1Ab / Ac Genetic rice TT51-1, transgenic cry3Bb Genetic corn MON863, MON88017, transgenic cry3A Corn MIR604, transfer cry1F Corn TC1507, transfer cry34Ab and cry35Ab Genetic corn 59122 and other 13 insect-resistant genetically modified crops, as well as non-genetically modified crops.
[0088] In this example, only the cry2Ab The LAMP amplification products of transgenic corn MON89034 and transgenic cotton MON15985 of the gene have typical amplification curves, while other transgenic crops have typical ampli...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
