AvrBs3/pthA family gene jval containing HD to NG virulence factor modes
A technology of factors and patterns, applied in the field of avrBs3/pthA family gene jva1, can solve the problem of insufficient understanding of avrBs3/pthA family member genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0015] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0016] The first part, the gene cloning of jva1 of the present invention
[0017] The present invention contains the avrBs3 / pthA family gene jva1 of HD to NG toxicity factor pattern, and the ribonucleic acid molecular sequence of the gene is:
[0018]ATGGATCCCATTCGTTCGCGCACGCCAAGTCCTGCCCGCGAGCTTCTGCCCGGACCCCAACCGGATAGGGTTCAGCCGACTGCAGATCGGGGGGGGGCTCCGCCTGCTGGCGGCCCCCTGGATGGCTTGCCCGCTCGGCGGACGATGTCCCGGACCCGGCTGCCATCTCCCCCTGCGCCCTCGCCTGCGTTCTCGGCGGGCAGCTTCAGCGATCTGCTCCGTCAGTTCGATCCGTCGCTTCTTGATACATCGCTTCTTGATTCGATGCCTGCCGTCGGCACGCCGCATACAGCGGCTGCCCCAGCAGAATGGGATGAGGCGCAATCGGGTCTGCGTGCAGCCGATGACCCGCCACCCACCGTGCCTGTCGCTGTCACTGCCGCGCGGCCGCCGCGCGCCAAGCCGGCCCCGCGACGGCGTGCGGCGCAACCCTCCGACGCTTCGCCGGCCGCGCAGGTGGATCTACGCACGCTCGGCTACAGTCAGCAGCAGCAAGAGAAGATCAAACCGAAGGTGCGTTCGACAGTGGCGCAGCACCACGAGGCACTGGTGGGCCATGGGTTTACACACGCGCACATCGTTGCGCTCAGCCAACACCCGGCAG...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com