Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence and cloning method thereof

A technology for metallothionein and hyper-accumulating plants, which is applied in the field of hyper-accumulating plant metallothionein (MT-L2) gene sequence and its cloning, and can solve problems such as unclear mechanism

Inactive Publication Date: 2014-07-23
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The expression of plant MT-L gene is tissue-organ-specific and developmental-stage-specific. At present, the most studied is the effect of metal ions on the expression of plant MT-L gene. Studies have reported the relationship between plant MT-L gene and the tolerance of heavy metal Cd. There is a certain correlation, but the mechanism of metal ions affecting the expression of MT-L gene is still not very clear, especially what role MT-L gene plays in heavy metal hyperaccumulation plants is currently a research hotspot in this field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence and cloning method thereof
  • Hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence and cloning method thereof
  • Hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence and cloning method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Solanum nigrum MT-L2a gene is shown in SEQ ID NO.1:

[0019] atgtcttgct gtggaggaag ctgtggctgt ggatctggct gcaagtgcgg cagtggctgtggaggatgtg ggatgtaccc tgacttggag agcaccacta cctttaccat cattgagggtgttgcaccta tgatgaacta tggaaaggtt gagggaggac ctaagaatgc aacagaaggtggaaatggct gcaaatgtgg atcaatctct agaggatccc cgggtaccga gctcgaatcgtaa

[0020] (a) Sequential features:

[0021] ●Length: 243bp1-242 nucleotides

[0022] ●Type: Nucleotide sequence

[0023] ●Chain type: single chain

[0024] ●Topological structure: linear

[0025] (b) Molecule type: double-stranded DNA

[0026] (c) Assumption: No

[0027] (d) Antisense: No

[0028] (e) Original source: Nightshade

[0029] Solanum nigrum MT-L2b gene is shown in SEQ ID NO.2:

[0030] atgtcttgct gtggaggaag ctgtggctgt ggatctggct gcaagtgcgg cagtggctgtggaggatgtg ggatgtaccc tgacttggag agcaccacta cctttaccat cattgagggtgttgcaccta tgatgaacta tggaaaggtt gagggaggac ctaagaatgc aacagaaggaggaaatggct gcaaatgtgg atcaatcgtc gacctgcagg catgcaagct t...

Embodiment 2

[0040] The cloning method of embodiment 2 Solanum nigrum MT-L2 gene

[0041] The method for cloning the above-mentioned MT-L2 gene from Solanum nigrum is:

[0042] (1) Total RNA was extracted from the leaves of the fresh hyperaccumulator plant Solanum nigrum;

[0043] (2) Using total RNA as a template, the first-strand cDNA was synthesized using reverse transcriptase AMV and random primers (Random Primers, Invitrogen, USA);

[0044] (3) Using the synthesized first-strand cDNA as a template, PCR amplification was carried out using degenerate primers MT-L2-F and MT-L2-R, and the size of the amplified fragment was about 200bp (see figure 1 );

[0045] (4) After cloning the PCR product into the pMD-18T vector, multiple positive clones were taken and sequenced to finally obtain the gene sequences MT-L2a and MT-L2b of the super-enriched plant Solanum nigrum type 2 metallothionein.

[0046] Wherein said primers include:

[0047] MT-L2-F: 5'-ATGTCTTGCTGTGGAGGAAN-3'

[0048] MT-L2...

Embodiment 3

[0101] Example 3 Expression of Hyperaccumulator Solanum nigrum Type 2 Metallothionein under Different Concentrations of Cd Stress

[0102] Solanum nigrum seedlings shown in the above sequence table SEQ ID NO.1 or SEQ ID NO.2 were planted in soil with different concentrations of Cd (2.5mg / kg, 5mg / kg and 40mg / kg) and without Cd In the middle to mature stage, the total RNA of Solanum nigrum leaves in different treatment groups (2.5mg / kg, 5mg / kg and 40mg / kg) and the control group (without Cd treatment) was collected. For the extraction method of total RNA, refer to the above examples, and use fluorescence quantification A PCR instrument (ABI Step-One Plus Real Time PCR System, USA) was used for differential expression analysis, and quantitative PCR primers were MT-L2-F and MT-L2-R. The results showed that Cd stress treatment could significantly induce the expression of MT-L2, which was 0.8 times, 2.8 times and 14.2 times that of the control, respectively (see figure 2 ), which i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of gene cloning in molecular biology, and particularly relates to a hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence and a cloning method thereof. The hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence is a 2-type metallothionein gene with a gene sequence shown as the nucleotide sequence in the SEQ ID NO.1 or SEQ ID NO.2. Success cloning and sequencing of the hyperaccumulating black-nightshade metallothionein like (MT-L2) gene sequence lay foundations for further analysis of biological stress resistance under the influence of MT-L2, and for screening and applications of other functions of the MT-2.

Description

technical field [0001] The invention belongs to the field of gene cloning in molecular biology, and specifically relates to a hyperaccumulator plant metallothionein (MT-L2) gene sequence and a cloning method thereof. Background technique [0002] Metallothionein (MTs) is a kind of polypeptide with low molecular weight, high Cys content and metal binding ability, which was first found in the horse kidney tissue that accumulates cadmium, and the protein isolated from plants that is homologous to animal MTs is It is called plant-like metallothionein (Metallothionein Like, MT-L). It was first discovered from soybean roots by Casterline and Barnett in 1977. According to the location and arrangement of Cys, plant metallothioneins are divided into three categories. MT-L1 has 6 Cys-X-Cys units, the C-terminal and N-terminal domains each contain 3, and there is a Cys-free spacer composed of about 40 amino acid residues between the 2 structural domains, the spacer More amino acid r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/10C07K14/825
Inventor 张倩茹魏树和焦洪静
Owner SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com