Supercharge Your Innovation With Domain-Expert AI Agents!

Hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and cloning method thereof

A technique for metallothionein and hyperaccumulation plants, which is applied in the field of hyperaccumulation plant nightshade metallothionein gene (MT-L3) sequence and its cloning, and can solve the problem that the mechanism is not very clear.

Inactive Publication Date: 2014-07-23
SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The expression of plant MT-L gene is tissue-organ-specific and developmental-stage-specific. At present, the most studied is the effect of metal ions on the expression of plant MT-L gene. Studies have reported the relationship between plant MT-L gene and the tolerance of heavy metal Cd. There is a certain correlation, but the mechanism of metal ions affecting the expression of MT-L gene is still not very clear, especially what role MT-L gene plays in heavy metal hyperaccumulation plants is currently a research hotspot in this field

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and cloning method thereof
  • Hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and cloning method thereof
  • Hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and cloning method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Solanum nigrum MT-L3 gene is shown in SEQ ID NO.1:

[0019] atgacggaca agtgtagcaa ttgcgattgc gctgatgtca gccaatgcgt gaggaaggagagccaatatg atgtcgtcat cgtcgaaaag agctacatcg agacggtggt gatgatggacgttggagcgg aagaacatga tggaaaatgc aaatgcggca gcagctgcgc ctgtgttaactgcacttagtg ctcatta

[0020] (a) Sequence features:

[0021] ●Length: 200bp 1-198 nucleotides

[0022] ●Type: Nucleotide sequence

[0023] ●Chain type: single chain

[0024] ●Topology: Linear

[0025] (b) Molecular type: double-stranded DNA

[0026] (c) Assumption: No

[0027] (d) Antonym: No

[0028] (e) Original source: Solanum nigrum

Embodiment 2

[0029] The cloning method of embodiment 2 Solanum nigrum MT-L3 gene

[0030] The method for cloning the above-mentioned MT-L3 gene from Solanum nigrum is:

[0031] (1) Extracting total RNA from the leaves of the fresh hyperaccumulated plant Solanum nigrum;

[0032] (2) Using total RNA as a template, the first-strand cDNA was synthesized using reverse transcriptase AMV and random primers (Random Primers, Invitrogen, USA);

[0033] (3) Using the synthesized first-strand cDNA as a template, use degenerate primers MT-L3-F and MT-L3-R for PCR amplification, and the amplified fragment size is about 200bp (see figure 1 );

[0034] (4) After the PCR product was cloned into the pMD-18T vector, the positive clones were taken and sequenced to obtain the gene sequence of the hyper-enriched plant Solanum nigrum type 3 metallothionein protein.

[0035] Wherein the primers include:

[0036] MT-L3-F: 5'-ATGTCGGACAAGTGYRGYARTTG-3'

[0037] MT-L3-R: 5'-TTAATGAGCACAAGTGCAGTTAAC-3'

[0038]...

Embodiment 3

[0075] Example 3 Expression of hyper-enriched plant Solanum nigrum type 3 metallothionein under different concentrations of Cd stress

[0076] The Solanum nigrum seedlings shown in the above-mentioned sequence table SEQ ID NO.1 are planted in the soil with different concentrations of Cd (2.5mg / kg, 5mg / kg and 40mg / kg) and no Cd added to the maturity stage, take different The total RNA of Solanum nigrum leaves of the treatment group (2.5mg / kg, 5mg / kg and 40mg / kg) and the control group (no Cd treatment), the total RNA extraction method refers to the above example, using a fluorescence quantitative PCR instrument (ABIStep-One Plus Real Time PCR System, USA) for differential expression analysis, quantitative PCR primers were MT-L3-F and MT-L3-R. The results showed that Cd stress treatment could significantly induce the expression of MT-L3, which was 2.4 times, 3.7 times, and 31.3 times that of the control, respectively (see figure 2 ), which is closely related to the ability of S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of gene clone in molecular biology, and specifically relates to a hyperaccumulator solanum nigrum metallothionein gene (MT-L3) sequence and a cloning method thereof. The hyperaccumulator solanum nigrum metallothionein gene sequence is type 3 metallothionein gene, and the gene sequence is shown by a nucleotide sequence in SEQ ID NO. 1. The successive cloning and sequencing of the hyperaccumulator solanum nigrum type 3 metallothionein gene helps to establish a base for further analyzing the biological stress resistant capability under the influence of MT-L3, and screening and applying other functions of MT-L3.

Description

technical field [0001] The invention belongs to the field of gene cloning in molecular biology, in particular to a super-enriched plant nightshade metallothionein gene (MT-L3) sequence and a cloning method thereof. Background technique [0002] Metallothioneins (MTs) are a class of low molecular weight, high Cys content and metal-binding polypeptides, which were first discovered in cadmium-accumulating horse kidney tissue. Known as plant metallothionein (Metallothionein Like, MT-L). It was first discovered from soybean roots by Casterline and Barnett in 1977. According to the position and arrangement of Cys, plant metallothionein proteins are divided into three categories. MT-L1 has 6 Cys-X-Cys units, each of which contains 3 C-terminal and N-terminal domains. Between the two domains is a Cys-free spacer composed of about 40 amino acid residues. A large number of amino acid residues is a common feature of most plant MTs; MT-L2 is similar to MT-L1, but the first and second...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/10C07K14/825
Inventor 张倩茹魏树和焦洪静
Owner SHENYANG INST OF APPLIED ECOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More