Single domain antibodies as inhibitors of PCSK9

An antibody, CDR2 technology, applied in the direction of antibodies, anti-enzyme immunoglobulin, biochemical equipment and methods

Inactive Publication Date: 2014-11-26
ADAERATA +1
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although well tolerated by most patients, adverse side effects are still being collected (https: / / www.statineffects.com / info / )

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single domain antibodies as inhibitors of PCSK9
  • Single domain antibodies as inhibitors of PCSK9
  • Single domain antibodies as inhibitors of PCSK9

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0552] Example 1: Production and purification of recombinant PCSK9 protein

[0553] From 35L Baculovirus High Five TM Cells produce a large amount of PCSK9-(His) 6 and it was subjected to multiple purification steps, sequentially including Ni 2+ Affinity purification followed by mono-Q TM Anion exchange and finally gel filtration chromatography. The results of Coomassie blue staining (Coomassie blue staining) of 18 μg of total protein separated from each preparation under non-reducing conditions in MES buffer SDS-PAGE with a gradient of 4-12% are shown in figure 1 In A. Location of molecular size markers (M); High Five prior to purification TM Total protein in supernatant (S); by Ni 2+ Affinity Chromatography (Ni), SOURCETM 15Q Anion Exchange (Q) and Superdex TM 200 gel filtration (GF) for purification. M: Marker 12 (25 μl); S, supernatant (10 μl); Ni, Ni-NTA pool (18 μg); Q, SOURCE Q pool (18 μg); GF, gel filtration pool from batch 7 (18 μg), GFB: Gel Filtration Ce...

Embodiment 2

[0554] Example 2: Immunization of llamas with purified PCSK9 protein

[0555] Isolation from immune phage display libraries is the easiest way to generate high affinity sdAbs. This involves immunizing llamas with antigen; monitoring the immune response; constructing phage display libraries; and subsequent phage display panning. Several injections of a human purified PCSK9 heterodimeric complex formed by the prosegment (amino acids 31 to 152) and the catalytic subunit (amino acids 153 to 692) were used to immunize llamas. The immune response was monitored and characterized using reactivity against PCSK9. Figure 1B and 1 C shows the immune response of the llama. While in [B] the llama immune response is evident after 4 and 8 immunizations, in [C] the results show 4 and 8 immunizations when lower concentrations of antigen (PCSK9) are used There is indeed a difference - indicating that very high affinity Abs may be present after 8 weeks of immunization. After immunization of...

Embodiment 3

[0556] Example 3: Screening for Vs specific for PSCK9 H H domain (sdAb)

[0557] Use V to camel IgG H / V H Primer pairs specific for both H and hinge regions encode V H and V H H DNA was amplified. will V H The H segment is based on its size relative to the V H separate. Use pair V H H Specific primers amplify V H H gene and clone it into a phagemid-based phage display vector. More specifically, three different sense primers (termed J' and corresponding to the 5' end of IgG) were used (including MJ1 (GCCCAGCCGGCCATGG CCSMKGTGCAGCTGGTGGAKTCTGGGGGA (SEQ ID NO: 144)), MJ2 (CAGCCGGCCATGGCCCAGGTAAAGCTGGAGGAGTCT GGGGGA (SEQ ID NO: 145)) and MJ3 (GCCCAGCCGGCCATGG CCCAGGCTCAGGTACAGCTGGTGGAGTCT (SEQ ID NO: 146))) and two antisense primers corresponding to the CH2 domain DNA sequence (CH2 (CGCCATCA AGGTACCAGTTGA (SEQ ID NO: 147)) and CH2b3 (GGGGTACCTG TCATCCACGGACCAGCTGA ( SEQ ID NO:148)) to amplify the VH-CH1-hinge-CH2 region or V of conventional IgG H H-Hinge-CH2. The app...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Antibodies (e.g., sdAbs) binding to PCSK9 are described. Nucleic acids encoding such Abs, host cells expressing such Abs and pharmaceutical composition comprising same are described. The use of these PCSK9-binding Abs for lowering low-density lipoprotein-cholesterol (LDL-C) levels and for the treatment of cardiovascular disorders, is also described.

Description

[0001] Cross References to Related Applications [0002] This application is PCT Application No. PCT / CA2012 / * filed on December 20, 2012 and published in English under PCT Rule 21(2), which itself claims U.S. Provisional Application Serial No. 61 filed on December 20, 2011 / 578,000 equity. All of the above documents are incorporated herein by reference in their entirety. technical field [0003] The present invention relates generally to cardiovascular disorders, and more particularly to reducing circulating levels of low density lipoprotein-cholesterol (LDL-C). [0004] About the sequence listing [0005] A Sequence Listing is concurrently filed pursuant to 37 C.F.R. 1.821(c) in an ASCII-compatible text file named 12810_458_ST25.TXT created December 19, 2012 and 92 Kb (kilobytes) in size. The contents of the above documents are incorporated herein by reference in their entirety. Background technique [0006] Worldwide, complications arising from cardiovascular disorders...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/40A61K39/395A61P3/06C12N15/13G01N33/573
CPCC07K16/40G01N33/5735C07K2317/569G01N2333/96433C07K2317/565C07K2317/76C07K2317/77C07K2317/22C07K2317/92A61P3/06A61P43/00C07K2317/567
InventorN·G·赛义达J·张
OwnerADAERATA