Primers, detection kit and preparation method for detecting foot-and-mouth disease asia type 1 virus
A detection kit and technology for foot-and-mouth disease, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of long time, low sensitivity, and inability to type.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] The present invention is explained in detail below in conjunction with embodiment.
[0022] 1. Preparation of Sequences
[0023] According to the GeXP primer design requirements and the FMDV-Asia1 genome published by NCBI, select the conserved region to design specific primers, and form specific chimeric primers by adding universal primers, while the universal primer sequences belong to non-biologically derived nucleotide sequences , in addition to synthesizing the universal primer sequence, and adding a Cy5 fluorescent label to the 5' end of the upstream universal primer. The primer sequence of the present invention that can specifically amplify the foot-and-mouth disease Asia1 virus nucleic acid is: AGGTGACACTATAGAATAACTGCCTACCAGAAGCAACC, which is named FMDV-Asia1-F in the present invention; GTACGACTCACTATAGGGAAGTATGTCTCCGCACGCTTC, which is named FMDV-Asia1-R in the present invention. Universal primers used in the present invention: Cy5AGGTGACACTATAGAATA, named UWD-F...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



