Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

TAT-BH3-Ndelta19 RhoGDI2 fusion protein, and preparation method and application thereof

A TAT-BH3-N, fusion protein technology, applied in the biological field

Inactive Publication Date: 2015-02-18
EAST CHINA UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research of NΔ19 RhoGDI2 mainly focuses on its mechanism of inhibiting tumor growth and metastasis, and the fusion expression of TAT penetrating peptide, pro-apoptotic short peptide BH3 and NΔ19 RhoGDI2 through the use of genetic engineering technology, in order to promote the apoptosis of cancer cells , to improve the tumor suppressive effect, which has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TAT-BH3-Ndelta19 RhoGDI2 fusion protein, and preparation method and application thereof
  • TAT-BH3-Ndelta19 RhoGDI2 fusion protein, and preparation method and application thereof
  • TAT-BH3-Ndelta19 RhoGDI2 fusion protein, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] A TAT-BH3-NΔ19 RhoGDI2 fusion protein, which is a fusion protein formed by connecting a TAT membrane-penetrating peptide and a short pro-apoptotic peptide BH3 at the N-terminus of NΔ19 RhoGDI2. The amino acid sequence of the fusion protein is shown in SEQ ID NO: 1 .

[0030] The amino acid sequence of the TAT membrane-penetrating peptide is shown in SEQ ID NO: 2, the amino acid sequence of the proapoptotic short peptide BH3 is shown in SEQ ID NO: 3, and the amino acid sequence of NΔ19 RhoGDI2 is shown in SEQ ID NO: 4.

[0031] The nucleotide sequence of the gene encoding the fusion protein is shown in SEQ ID NO:5.

[0032] A method for preparing a TAT-BH3-NΔ19 RhoGDI2 fusion protein, the method comprising the following steps:

[0033] (1) Construction of pPAL7 / eXact-TAT-BH3-NΔ19 RhoGDI2 recombinant plasmid:

[0034] a. Obtain the coding gene of TAT-BH3-NΔ19 RhoGDI2 fusion protein. Such as figure 1 As shown, the full-length RhoGDI2 gene is used as a template, wherein...

Embodiment 2

[0049] Preparation of BH3-TAT-NΔ19 RhoGDI2 fusion protein

[0050] (1) Construction of pPAL7 / eXact-BH3-TAT-NΔ19 RhoGDI2 recombinant plasmid.

[0051] a. Obtain the gene encoding the BH3-TAT-NΔ19 RhoGDI2 fusion protein. Using the full-length RhoGDI2 gene as a template, using the upstream primers containing the coding sequences of the pro-apoptotic short peptide BH3 and TAT and the downstream primers containing the coding sequences of RhoGDI2, the pro-apoptotic short peptides BH3 and TAT were amplified by PCR. The gene encoding the membrane peptide was tandem fused to the N-terminus of the NΔ19 RhoGDI2 gene to obtain the gene encoding the BH3-TAT-NΔ19 RhoGDI2 fusion protein.

[0052] Upstream primer: 5'-CCCAAGCTTTG ATGCTGCGGCGGATGGCGGAGGAGCTGAAC AGCAAGCTCAATTATAAGCCT-3′ (the underline indicates the BH3 coding sequence, and the wavy line indicates the TAT penetrating peptide coding sequence)

[0053] Downstream primer: 5'-CGCGGATCCTCATTCTGTCCACTCCTTCTT-3'

[0054] The co...

Embodiment 3

[0059] Preparation of TAT-NΔ19 RhoGDI2-BH3 fusion protein

[0060] (1) Construction of pPAL7 / eXact-TAT-NΔ19 RhoGDI2-BH3 recombinant plasmid.

[0061] a. Obtain the coding gene of TAT-NΔ19 RhoGDI2-BH3 fusion protein. Using the full-length RhoGDI2 gene as a template, the TAT penetrating peptide and the pro-apoptotic short peptide BH3 were fused to the At both ends of the NΔ19 RhoGDI2 gene, the TAT-NΔ19 RhoGDI2-BH3 fusion protein coding gene was obtained.

[0062] Upstream primer: 5'-CCCAAGCTTTG TATGGCAGGAAGAAGCGTAGACAGAGAGACGTAGA AGCAAGCTCAATTATAAGCCT-3′ (underline indicates TAT ​​penetrating peptide coding sequence)

[0063] Downstream primer: 5'-CGCGGATCCTCA TTCTGTCCACTCCTTCTT-3' (the wavy line indicates the BH3 coding sequence)

[0064] The conditions of the PCR reaction were: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 50 s, 30 cycles, and finally extension at 72°C for 5 min. The PCR product was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a TAT-BH3-Ndelta19 RhoGDI2 fusion protein, and a preparation method and application thereof. A TAT cell-penetrating peptide and a pro-apoptotic oligopeptide BH3 are connected in series with a fusion protein formed at the N end of Ndelta19 RhoGDI2, and an amino acid sequence of the fusion protein is shown as SEQ ID No:1. The preparation method for the fusion protein comprises the following steps: (1) constructing a pPAL7 / eXact-TAT-BH3-Ndelta19 RhoGDI2 recombinant plasmid; (2) heterogeneously expressing an eXact-TAT-BH3-Ndelta19 RhoGDI2 fusion protein by utilizing Escherichia coli BL21; (3) separating and purifying the eXact-TAT-BH3-Ndelta19 RhoGDI2 fusion protein. Compared with the prior art, the TAT-BH3-Ndelta19 RhoGDI2 fusion protein is prepared for the first time, and the purity reaches 92.5 percent; MTT and Transwell experiments show that the purified TAT-BH3-Ndelta19 RhoGDI2 fusion protein has obvious proliferation and invasion inhibition effects on cancer cells comprising bladder cancer T24 cells.

Description

technical field [0001] The invention relates to a fusion protein and a preparation method thereof, in particular to a TAT-BH3-NΔ19RhoGDI2 fusion protein, a preparation method and application thereof, belonging to the field of biotechnology. Background technique [0002] Since the discovery of RhoGDI2 by Leffers et al., people's understanding of it has increased day by day. In recent years, the relationship between RhoGDI2 and cancer has gradually become known. RhoGDI2 is one of the members of the RhoGDI family and plays an important regulatory role in inhibiting the activity of the Rho family. Studies have found that RhoGDI2 is down-regulated in bladder cancer, lung cancer and Hodgkin's lymphoma, and participates in the process of cell apoptosis. RhoGDI2 has two caspase family cleavage sites. NΔ19 RhoGDI2 is the N-terminus of RhoGDI2 lacking the first 19 amino acid residues during apoptosis. NΔ19 RhoGDI2 is the cleavage product of caspase-3, and it migrates to the nucleu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/13C12N15/70A61K38/08A61K38/17A61P35/00
Inventor 孙爱友魏东芝赵志强徐瑞
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com