Multifunctional TA cloning vector system for blue-white selection and application of multifunctional TA cloning vector system

A cloning vector and blue-white screening technology, applied in the field of molecular biology, can solve the problems of high false positive and false negative rates, reduce false positives and false negatives, and save costs and time

Inactive Publication Date: 2015-02-18
SUZHOU UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Despite more than three decades of blue-white screening, false positive and false negative rates remain high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multifunctional TA cloning vector system for blue-white selection and application of multifunctional TA cloning vector system
  • Multifunctional TA cloning vector system for blue-white selection and application of multifunctional TA cloning vector system
  • Multifunctional TA cloning vector system for blue-white selection and application of multifunctional TA cloning vector system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 3 99

[0031] TA clone of embodiment one to three, 99bp target product

[0032] The experimental steps are as follows:

[0033]Using human whole blood sample genomic DNA as a template, using primer pairs A and B, PCR amplification was performed to obtain a target product of 99bp;

[0034] The PCR amplification system was: 12.5 μL of 2 X Tag mix (Biomega, Shanghai), forward primer: 10 μM, reverse primer: 10 μM, genome 40 ng, and water was added to the total volume of 25 μL.

[0035] The PCR amplification reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 20S, annealing at 50°C for 20S, extension at 72°C for 30S, a total of 30 cycles, and finally 10min at 72°C.

[0036] By means of TA cloning, the gel-purified 99bp target product was ligated into the vectors pMD19-JZ3, pMD19-JZ2, and pMD19-JZ1, respectively

[0037] The ligation system is: 1uL of 10×T4DNA Ligase Buffer, 0.5uL of T4DNA Ligase, 1uL of pMD19-JZ3 / pMD19-JZ2 / pMD19-JZ1, 0.1pmol...

Embodiment 5 51b

[0045] Embodiment 5. TA clone of 51bp target product (integral multiple of 3)

[0046] The 51bp target product was directly designed and sent to Invitrogen (Shanghai, China) for synthesis. The sequence is 51-1TTGCATCAACCCCATCATCTATAGATCTGTCGGGGAGAAGTTCAGAAACTA(Seq No.6)

[0047] 51-2 TAGTTTCTGAACTTCTCCCCGACAGATCTATAGATGATGGGGTTGATGCAA(Seq No.7)

[0048] When cloned into the pMD19-JZ3 vector, the positive results were mostly blue colonies; when cloned into the pMD19-JZ1 vector, the positive results were mostly white colonies. Figure 5 The blue and white plate results of the colony (A is the pMD19-JZ3 vector; B is the pMD19-JZ1 vector). Image 6 The sequencing results of inserting the target fragment into the pMD19-JZ1 vector are in full agreement with the expected results.

[0049] The above practical application examples show that the vectors pMD19-JZ2 and pMD19-JZ1 can achieve a new selection system in which the control blank is white to a certain condition that the clone...

Embodiment 6

[0050] Example 6. Gene detection of minimal lesions of the P53 gene

[0051] The improvement of the cloning efficiency makes it possible for the product of the present invention to be used for the gene detection of minimal lesions. Practical application example 7 takes the common P53 gene in human tumors as an example. The technical route of the embodiment is as follows: primers are designed for exons 5, 6, 7, 8, and 9 of the P53 gene (see Table 2A for primer sequences), and PCR is performed with tumor genomic DNA as a template. The PCR product was inserted into the pMD19-JZ3 vector, and the colony color was observed. Blue colonies were picked and sequenced. The specific experimental information is shown in Table 2B.

[0052] Table 2A

[0053]

[0054] Table 2B

[0055]

[0056]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a multifunctional TA cloning vector system by a method of regulating a coding framework. Compared with a conventional commercialized TA vector, the multifunctional TA cloning vector has the advantages that the false positive and false negative rate during TA cloning can be reduced, and the self-ligation phenomenon of the vector is remarkably improved. The multifunctional TA cloning vector system has the creative application of providing two selections of turning white from blue and turning blue from white to a bacterial colony after the TA cloning vector is inserted into a sequence, wherein the false positive and false negative rates are both lower than 1 percent in the section of turning blue from white. Moreover, the vector can be used for detecting minimal lesion of frameshift mutation of tumor related genes, and is a unique product with the detecting function on current market, and can be used for detecting effectiveness of trans factor protease TALENs.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to medical diagnosis and biotechnology. By adjusting the coding frame method, three TA cloning vectors were constructed. Compared with conventional commercial TA vectors, in addition to retaining the screening from blue to white, a new selection from white to blue is added, which can be used for the detection of small mutations and the detection of anti-factor nuclease activity. Background technique [0002] At present, most of the cloning vectors in molecular biology experiments are artificially constructed, basically with selectable genetic markers or phenotypic characteristics. Blue-white screening (β-galactosidase system) is a more commonly used selection marker. [0003] Such vectors carry the lacZ' gene, which encodes the N-terminus (α-peptide) of β-galactosidase, and in the inducer IPTG (isopropyl-β-D-thiogalactoside, structurally similar to lactose but cannot be degraded by ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N15/66C12Q1/68
Inventor李凯潘韵芝
OwnerSUZHOU UNIV