Preparation and application of fusion protein for treating hypercholesteremia

A technology of hypercholesterolemia and fusion protein, applied in the field of genetic engineering

Active Publication Date: 2015-04-29
CHENGDU KANGHONG BIOTECH
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Obviously, various methods of blocking PCSK9 may become new anti-PCSK9 drugs after therapeutic monoclonal antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application of fusion protein for treating hypercholesteremia
  • Preparation and application of fusion protein for treating hypercholesteremia
  • Preparation and application of fusion protein for treating hypercholesteremia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Preparation of fusion protein

[0033] 1. Plasmid construction

[0034] 1.1 Gene and primer synthesis

[0035] The expressed sequence was recombined into the expression vector by the following synthetic gene and primers. The gene and primers were synthesized by Beijing Jinweizhi Company, a professional company, and the synthetic gene sequence was recombined into the plasmid vector pUC19, named pUC19-EGFwt, pUC19-mEGF 14 , pUC19-mEGF 16 and pUC19-3M EGF.

[0036] Synthetic fusion protein gene fragment:

[0037] EGFwt:

[0038] ATCACCGGTATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGGACTGGGACCAACGAATGCTTGGACAACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGCCCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAGGCGGCGGCGGCTCCGGAGGAGGAGGATCCGGAGGAGGAGGATCCGACAAAACTCACACATGCCCAC

[0039] mEGF 14 :

[0040] ATCACCGGTATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGGACTGGGACCAACGAATGCTTGGACAACAACGGCGGCTGTTCCTACGTCTGCAATGACCTTAAGATCGGCTACGAGTG...

Embodiment 2

[0070] Embodiment 2 fusion protein bioactivity assay

[0071]The binding affinity of EGF-Fc fusion protein to PCSK9 was measured by biomembrane interferometry on Otect QK (Fortebio). The SA sensor sensor (Fortebio, product number 18-5063) was immobilized in PCSK9 containing 0.5% BSA and 1mM CaCl2 in TrisHCl pH 7.4 buffer, washed in the same buffer, and transferred to the buffer containing the same buffer. The concentration of 0-500 nM EGF-FC fusion protein in the wells. Signals for reference wells containing buffer only were subtracted from all binding data. Affinity KD was obtained by fitting to a steady state algorithm using Octet software. The determined KD values ​​summarized in Table I show a 15- to 50-fold increase in affinity for mEGF-Fc mutant and 3mEGF-FC tandem mutant fusion proteins compared to EGFwt-Fc.

[0072] Table I, Binding affinity of EGFwt-Fc, mEGF-Fc mutants and 3mEGF-FC tandem mutations to PCSK9. KD values ​​were determined by fitting the data to a ste...

Embodiment 3

[0074] Embodiment 3 fusion protein bioactivity assay

[0075] Human liver cancer HepG2 cells were cultured to the logarithmic growth phase, the cells were washed once with PBS, digested with trypsin to make a cell suspension, and the cell density was adjusted to 1×10 6 cells / ml. The cells were seeded in a 96-well culture plate (100 μl / well), and 200 μl of medium was added to the edge wells. Place the culture plate at 37°C, 5% CO 2 In the incubator, continue to cultivate for 24 hours. Remove the cell culture supernatant, add 100 μl serum-free cell culture medium to each well, and continue culturing in the CO2 incubator for 16 hours; discard the supernatant, replace with serum-free cell culture medium again, add PCSK9 (final concentration 25 μg / ml), and add EGFwt-FC (10-50μM) or 3mEGF-Fc (03-3μM) was incubated at 37°C in a 5% CO2 incubator for 4 hours; (The final concentration is 6 μg / ml) and incubate for 3 hours, remove the supernatant, wash the cells with PBS 3 times, pla...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a PCSK9-combined fusion protein which is represented by the following general formula: X-connecting peptide-Y-connecting peptide-Z-connecting peptide-IgG Fc segment, wherein X, Y and Z are EGF(A) region polypeptide mutants in LDL-R (low-density lipoprotein receptor), and the connecting peptide is (GGGGS)n. The fusion protein disclosed by the invention can be combined with the PCSK9 at high affinity to inhibit the PCSK9 from degrading the hepatocyte LDL-R and increase the intake of the hepatocytes for LDL-C, and thus, has obvious advantages and favorable prospects in the aspect of treating hypercholesteremia, familial hypercholesteremia and other diseases.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the preparation and application of a novel fusion protein. Background technique [0002] Hypercholesterolemia is characterized by lipoprotein metabolism disorder or blood lipid disorder, especially the increase of blood cholesterol low-density lipoprotein (LDL), which can cause stroke, coronary heart disease, lower extremity vascular disease, and atherosclerosis. At present, the main treatment drugs are statins, which can significantly reduce low-density lipoprotein cholesterol (LDL-C), and the level of LDL-C is closely related to the risk of coronary heart disease. Therefore, lowering LDL-C is the preferred goal in current lipid-lowering treatment guidelines. However, the treatment status of hypercholesterolemia is not optimistic. Most high-risk and very high-risk patients have not reached the LDL-C target value, even with the best statin drugs or increasing the drug dose. T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/63A61K38/17A61K47/48A61P3/06A61P3/00
Inventor付伟罗弟祥李生伟代燕平程琳高小平
OwnerCHENGDU KANGHONG BIOTECH