Method and kit for amplifying full-length dna barcodes from dried hemp fly specimens in collections

A kit and the technology of sargassum, applied in the field of amplifying the full length of DNA barcodes, can solve the problems of serious DNA degradation, difficulty in obtaining long fragments, long storage time, etc., and achieve high repeatability, great reliability and adaptability, good stability effect

Active Publication Date: 2017-12-12
岳巧云
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are a large number of insect specimens stored in museums, most of which are dried specimens. The dried insect specimens identified by experts, especially the type specimens used for species naming, are important sources for obtaining accurate species DNA barcode data. Insect specimens have been stored for a long time, and they have been in an environment with high insect and mildew resistance chemicals for a long time. The DNA degradation is serious. It is difficult to obtain long fragments with general amplification methods.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for amplifying full-length dna barcodes from dried hemp fly specimens in collections
  • Method and kit for amplifying full-length dna barcodes from dried hemp fly specimens in collections
  • Method and kit for amplifying full-length dna barcodes from dried hemp fly specimens in collections

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] (1) Based on the COI sequences of a part of the sarcophagus species published in Genbank (sequence numbers: JQ413458, JQ413452, JQ582102, JQ582072, JQ413461, JQ582073, JQ582071, JQ582069, JN231272), sequence analysis was carried out, and the following primers were designed and entrusted to Dalian Bao Amplification primers for DNA barcode sequences were synthesized by Biotech Ltd.

[0036] LCO1490: 5'-GGTCAACAAATCATAAAGATATTGG-3';

[0037] LCO1637: 5'-ATTGTTACAGCTCATGCTTTTATTA-3';

[0038] LCO1728: 5'-TCCTCGAATAAATAATATAAGTTTT-3';

[0039] HCO1856: 5'-GATAAACAGTTCATCCTGTTCCAGC-3';

[0040] HCO1995: 5'-AATACCTGTTGATCGTATATTAAT-3';

[0041] HCO2198: 5'-TAAACTTCAGGGTGACCAAAAAAATCA-3'.

[0042] (2) Using the lysate from the Animal Tissue Genomic DNA Extraction Kit (TIANGEN; Serial Number: DP304) from a hind leg of the Antelope spp. After soaking for more than 5 hours, the genomic DNA was extracted with an animal tissue genomic DNA extraction kit. Using LCO1490 and HCO1...

Embodiment 2

[0051] (1) Same as step (2) of Example 1, the difference is that the template is a hind leg extracted from the animal tissue genome DNA extraction kit in 1980 by the sarcophagus (Zhongshan Entry-Exit Inspection and Quarantine Bureau Vector Biological Specimen Room) The obtained genomic DNA was used to obtain the recombinant vector pGMT-2A. The sequence of Fragment 2A is as follows:

[0052] AACTTTATATTTTATTTTCGGAGCTTGAGCAGGAATAGTAGGAACATCACTAAGAATTCTTATTCGAGCAGAATTAGGTCACCCAGGAGCATTAATTGGTGATGATCAAATTTATAATGTAATCGTTACAGCACATGCCTTTATTATAATTTTCTTCATGGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTATCATACTAGGAGCTCCAGACATGGCTTTTCCTCGAATAAACAATATAAGTTTTTGACTTTTACCACCAGCATTAACACTTCTTCTAGTAAGCAGTATAGTAGAAAATGGA。

[0053] (2) Same as step (3) of Example 1, except that the template is the genomic DNA obtained by extracting a hind leg of the sarcophagus in 1980 through the animal tissue genomic DNA extraction kit to obtain the recombinant vector pGMT-2B. The sequence of Fragment 2B is as ...

Embodiment 3

[0060] (1) Same as step (2) of Example 1, the difference is that the template is obtained by extracting a hind leg of the flax fly (Zhongshan Entry-Exit Inspection and Quarantine Bureau Vector Biological Specimen Room) in 2001 through the animal tissue genomic DNA extraction kit Genomic DNA to obtain the recombinant vector pGMT-3A. The sequence of Fragment 3A is as follows:

[0061] AACTTTATACTTTATTTTTGGAGCTTGAGCAGGTATAGTAGGAACTTCACTAAGAATTCTTATTCGAGCAGAATTAGGTCATCCTGGTGCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGGTTTGGAAATTGACTAGTACCAATTATATTAGGAGCTCCAGACATGGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCAGCATTAACATTGCTTCTAGTAAGTAGTATAGTAGAAAATGGA。

[0062] (2) Same as step (3) of Example 1, except that the template is the genomic DNA obtained by extracting a hind leg of the flax fly in 2001 through the animal tissue genomic DNA extraction kit to obtain the recombinant vector pGMT-3B. The sequence of Fragment 3B is as follows:

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit for amplifying the full length of a DNA barcode from a dried sargassum fly specimen stored in a library. This method provides four primers, which are LCO1490, HCO1856, HCO2198 and LCO1728 respectively; using the genomic DNA of the dried sarcophagus specimens in the library as a template, and using LCO1490 and HCO1856 as primers to perform PCR, fragment A is obtained, and HCO2198 and LCO1728 are used as primers for PCR. Fragment B was obtained by PCR; Fragment A and Fragment B were spliced ​​to obtain the full-length DNA barcode of the dried Sarmus fly specimen in the library. A kit for carrying out this method comprises primers LCO1490, HCO1856, HCO2198 and LCO1728. The method provided by the invention is accurate and fast, and compared with other direct amplified full-length amplification results, the method has good versatility for the sargassum fly, high amplification efficiency, and greater reliability and adaptability.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a method and a kit for amplifying the full length of a DNA barcode from a dried sargassum fly specimen stored in a library. Background technique [0002] DNA barcoding technology is a new type of species identification based on modern advanced DNA amplification, sequencing and comparison technology, which uses a moderately conserved and easy-to-obtain gene segment commonly found in organisms as a standard in recent years. means. Compared with traditional morphological identification, the use of DNA barcodes for species identification has the following advantages: the identification of species will no longer be limited by the developmental state of the species, and overcome the shortcomings of eggs, larvae, and pupae that cannot be directly identified; Experience and professional background knowledge are greatly reduced, reducing the interference of subjective judgments; species iden...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/10
Inventor胡佳岳巧云邱德义陈健刘德星魏晓雅
Owner岳巧云