Factor VIII complex with XTEN and von willebrand factor protein, and uses thereof
A technology of hemophilia factor and FVIII, which is applied in the direction of expression enhancement stability/folded protein fusion, factor VII, blood coagulation/fibrinolysis factor, etc., and can solve problems such as half-life increase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0581] Example 1: Cloning of different VWF domains (Figure 1)
[0582] (a) Clone pSYN-VWF-002
[0583] pSYN-VWF-002 contains the nucleotide sequence encoding the VWF fragment, which is amino acids 1-477 of SEQ ID NO:100. [VWF-D'D3 protein sequence] Amino acid numbering indicates the mature VWF sequence without pro-peptide and corresponds to amino acids 764-1240 of SEQ ID NO:2. The pSYN-VWF-002 construct has a FVIII signal peptide at the N-terminus, which allows proper secretion of the synthetic protein and a subsequent 6xHis tag at the C-terminus (for protein purification). It was synthesized by using the following primer combinations:
[0584] ESC48-Fwd-VWF-D'D3 with VIII signal and BsiW1 site
[0585] TCGCGACGTACGGCCGCCACCATGCAAATAGAGCTCTCACCTGCTTCTTTCTGT
[0586] GCCTTTTGCGATTCTGCTTTAGCCTATCCTGTCGGCCCCCCATG (SEQ ID NO:
[0587] 90)
[0588] ESC51-Rev-VWF D'D3 with 6His and Not 1 sites (1-477 amino acids)
[0589] TGACCTCGAGCGGCCGCTCAGTGGTGATGGTGATGATGCGGCTCCTGGCAGGCT...
Embodiment 2
[0622] Example 2: Effect of D'D3 and XTEN fusions on FVIII half-life extension
[0623] To evaluate the D'D3FVIII half-life extension potential of rFVIII-XTEN fusion proteins, VWF D'D3 dimers were introduced into FVIII-VWF DKO mice by hydrodynamic injection of their corresponding DNA construct VWF-025 (Example 1) . After D'D3 had reached steady-state expression (day 5 post-injection), a single dose of rFVIII-XTEN was administered by intravenous injection at a dose of 200 IU / kg. Blood samples were collected up to 120 hours after rFVIII-XTEN administration. Plasma FVIII activity was analyzed by FVIII chromogenic assay. D'D3 expression levels were measured by VWF ELISA, and rFVIIIFc PK curves were analyzed using the WinNonlin program.
[0624] The results of the study are shown in Figure 2 and the PK parameters of rFVIII-XTEN with / without D'D3 in circulation are listed in Table 16. D'D3 dimer further prolongs rFIII-XTEN t 1 / 2 , increased 5 times from 3.4 hours to 17.8 hours....
Embodiment 3
[0635] Example 3: Plasmid Construction of XTEN Containing FVIII / VWF Constructs
[0636] (a) Clone pSYN-FVIII-161 (Figure 3)
[0637] The FVIII-161 plasmid contains a single-chain Fc (scFc) scaffold with an enzymatic cleavage site that is processed in the cell during synthesis. The construct has the FVIII binding domain (D'D3) of full length VWF.
[0638] A plasmid (pSYN-FVIII-161 ) was designed to express FVIII-Fc and VWF-Fc heterodimers in which the D'D3 domain binds to FVIII and prevents FVIII from interacting with phospholipids and activated protein C. Protein from pSYN-FVIII-161 is expressed in cells as a single polypeptide in which the C-terminus of the FVIII-Fc subunit is linked to VWF D'D3 via a 6x (GGGGS) polypeptide linker (SEQ ID NO: 64) - the N-terminus of the Fc subunit. In addition, RRRRS (SEQ ID NO: 11) and RKRRKR (SEQ ID NO: 10) sequences were inserted at the 5' and 3' ends of the polypeptide linker, respectively, for passage of the proprotein convertase foll...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap