Factor VIII complex with XTEN and von willebrand factor protein, and uses thereof

A technology of hemophilia factor and FVIII, which is applied in the direction of expression enhancement stability/folded protein fusion, factor VII, blood coagulation/fibrinolysis factor, etc., and can solve problems such as half-life increase

Inactive Publication Date: 2015-05-27
BIOVERATIV THERAPEUTICS INC
View PDF110 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, although the improvement is small, the increased half-life may indicate the presence of other T1 / 2 limiting factors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Factor VIII complex with XTEN and von willebrand factor protein, and uses thereof
  • Factor VIII complex with XTEN and von willebrand factor protein, and uses thereof
  • Factor VIII complex with XTEN and von willebrand factor protein, and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0581] Example 1: Cloning of different VWF domains (Figure 1)

[0582] (a) Clone pSYN-VWF-002

[0583] pSYN-VWF-002 contains the nucleotide sequence encoding the VWF fragment, which is amino acids 1-477 of SEQ ID NO:100. [VWF-D'D3 protein sequence] Amino acid numbering indicates the mature VWF sequence without pro-peptide and corresponds to amino acids 764-1240 of SEQ ID NO:2. The pSYN-VWF-002 construct has a FVIII signal peptide at the N-terminus, which allows proper secretion of the synthetic protein and a subsequent 6xHis tag at the C-terminus (for protein purification). It was synthesized by using the following primer combinations:

[0584] ESC48-Fwd-VWF-D'D3 with VIII signal and BsiW1 site

[0585] TCGCGACGTACGGCCGCCACCATGCAAATAGAGCTCTCACCTGCTTCTTTCTGT

[0586] GCCTTTTGCGATTCTGCTTTAGCCTATCCTGTCGGCCCCCCATG (SEQ ID NO:

[0587] 90)

[0588] ESC51-Rev-VWF D'D3 with 6His and Not 1 sites (1-477 amino acids)

[0589] TGACCTCGAGCGGCCGCTCAGTGGTGATGGTGATGATGCGGCTCCTGGCAGGCT...

Embodiment 2

[0622] Example 2: Effect of D'D3 and XTEN fusions on FVIII half-life extension

[0623] To evaluate the D'D3FVIII half-life extension potential of rFVIII-XTEN fusion proteins, VWF D'D3 dimers were introduced into FVIII-VWF DKO mice by hydrodynamic injection of their corresponding DNA construct VWF-025 (Example 1) . After D'D3 had reached steady-state expression (day 5 post-injection), a single dose of rFVIII-XTEN was administered by intravenous injection at a dose of 200 IU / kg. Blood samples were collected up to 120 hours after rFVIII-XTEN administration. Plasma FVIII activity was analyzed by FVIII chromogenic assay. D'D3 expression levels were measured by VWF ELISA, and rFVIIIFc PK curves were analyzed using the WinNonlin program.

[0624] The results of the study are shown in Figure 2 and the PK parameters of rFVIII-XTEN with / without D'D3 in circulation are listed in Table 16. D'D3 dimer further prolongs rFIII-XTEN t 1 / 2 , increased 5 times from 3.4 hours to 17.8 hours....

Embodiment 3

[0635] Example 3: Plasmid Construction of XTEN Containing FVIII / VWF Constructs

[0636] (a) Clone pSYN-FVIII-161 (Figure 3)

[0637] The FVIII-161 plasmid contains a single-chain Fc (scFc) scaffold with an enzymatic cleavage site that is processed in the cell during synthesis. The construct has the FVIII binding domain (D'D3) of full length VWF.

[0638] A plasmid (pSYN-FVIII-161 ) was designed to express FVIII-Fc and VWF-Fc heterodimers in which the D'D3 domain binds to FVIII and prevents FVIII from interacting with phospholipids and activated protein C. Protein from pSYN-FVIII-161 is expressed in cells as a single polypeptide in which the C-terminus of the FVIII-Fc subunit is linked to VWF D'D3 via a 6x (GGGGS) polypeptide linker (SEQ ID NO: 64) - the N-terminus of the Fc subunit. In addition, RRRRS (SEQ ID NO: 11) and RKRRKR (SEQ ID NO: 10) sequences were inserted at the 5' and 3' ends of the polypeptide linker, respectively, for passage of the proprotein convertase foll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention includes a chimeric protein comprising a VWF protein with D' domain and D3 domain ofVWF, one or more XTEN sequence, and a FVIII protein, wherein the VWF fragment, the XTEN sequence, or the FVIII protein are linked to or associated with each other. The chimeric protein can further comprise one or more Ig constant region or a portion thereof (e.g., an Fc region). A polypeptide chain of a VWF fragment is associated with a FVIII polypeptide chain linked to an XTEN sequence. The VWF fragment polypeptide chain can prevent or inhibit binding of endogenous VWF toFVIII protein linked to the XTEN sequence. By preventing or inhibiting binding of endogenous VWF to FVIII protein, VWF fragment can extend half-life of chimeric protein comprising FVIII protein. The invention includes nucleotides, vectors, host cells, use of VWF fragment, or chimeric proteins.

Description

Background of the invention [0001] Hemophilia A is a bleeding disorder caused by a defect in the gene encoding clotting factor VIII (FVIII) and affects 1-2 boys born in 10,000. Graw et al., Nat. Rev. Genet. 6(6):488-501 (2005). Patients with hemophilia A can be treated by infusion of purified or recombinantly produced FVIII. However, all commercially available FVIII products are known to have a half-life of about 8-12 hours, requiring frequent intravenous administration to patients. See Weiner M.A. and Cairo, M.S., Pediatric Hematology Secrets, Lee, M.T., 12. Disorders of Coagulation, Elsevier Health Sciences, 2001; Lillicrap, D. Thromb. Res. 122 Suppl 4:S2-8 (2008). Furthermore, many approaches have been attempted to prolong the half-life of FVIII. For example, developmental approaches to prolong the half-life of coagulation factors include pegylation, glycopegylation, and conjugation to albumin. See Dumont et al., Blood. 119(13):3024-3030 (published online Jan. 13, 2012)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K38/37C12N15/00C12P21/08
CPCA61P7/04A61K38/37A61K39/395C12N15/00C07K2319/00C07K2319/30C07K2319/31C07K2319/50C07K14/755A61P43/00A61K38/00A61K38/36A61K47/55C07K16/00C07K2319/35C12N15/11C07K19/00
Inventor伊克塔·赛思·切布拉刘童瑶常佩云罗伯特·T·彼得斯约翰·库曼
OwnerBIOVERATIV THERAPEUTICS INC