A kind of small molecule inhibitor and its application in inhibiting ornithine decarboxylase
A technology of small molecule inhibitors and ornithine decarboxylase, which is applied in the direction of anti-infective drugs, drug combinations, anti-tumor drugs, etc., can solve the problems of high concentration, weak binding ability, and large toxic and side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] The small molecule inhibitor involved is: 3-Benzoylamino-benzoic acid ethyl ester, the structural formula is shown in the figure.
[0044]
[0045] The activity detection method is as follows:
[0046] 1. Construction of human ODC prokaryotic expression plasmid
[0047] The gene sequence of human ODC was inserted into the pET28a plasmid through BamH I and Xho I restriction sites to construct the pET28a-hODC plasmid, which was verified by DNA sequencing.
[0048] Gene sequence of human ODC:
[0049] atgaacaactttggtaatgaagagtttgactgccacttcctcgatgaaggttttactgccaaggacattctggaccagaaaattaatgaagtttcttcttctgatgataaggatgccttctatgtggcagacctgggagacattctaaagaaacatctgaggtggttaaaagctctccctcgtgtcacccccttttatgcagtcaaatgtaatgatagcaaagccatcgtgaagacccttgctgctaccgggacaggatttgactgtgctagcaagactgaaatacagttggtgcagagtctgggggtgcctccagagaggattatctatgcaaatccttgtaaacaagtatctcaaattaagtatgctgctaataatggagtccagatgatgacttttgatagtgaagttgagttgatgaaagttgccagagcacatcccaaagcaaagttggttttgcggattgccactgatga...
Embodiment 2
[0069] The small molecule inhibitor involved is: N-(3-Acetyl-phenyl)-benzamide, the structural formula is shown in the figure:
[0070]
Embodiment 3
[0072] The small molecule inhibitor involved is: N-(4-Propoxy-phenyl)-benzamide, the structural formula is shown in the figure:
[0073]
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap