Method for identifying Tilletia controversa Kuhn by adopting Taqman probe technology, and kit thereof

Abstract

The invention discloses a method for identifying Tilletia controversa Kuhn by adopting a Taqman probe technology, and a kit thereof, and relates to a plant disease detection technology. The method comprises the following steps: 1, obtaining the real-time quantitative standard curve of a TCK positive plasmid standard substance, wherein the Ct value is ordinate, and the initial template copy number is abscissa; 2, extracting DNA of a sample to be measured; 3, carrying out a real-time fluorescent quantitative PCR reaction with the DNA of the sample to be measured as a template; and 4, obtaining the copy number of TCK in the sample to be measured according to a Ct value obtained through the real-time fluorescent quantitative PCR reaction and the real-time quantitative standard curve. Primers adopted in the real-time fluorescent quantitative PCR reaction comprise an upstream primer ACGACCGACTTTCCGAGAGC and a downstream primer GTGTGGGACGAAGGCATCAA; and the Taqman probe is FAM 5'-ACGACTTGCGGTCCCTCCACA-3'. The invention also provides the kit based on the method.

Description

technical field [0001] The invention relates to a plant disease detection technology, in particular to a method for identifying Tilletia controversa Kühn by using a Taqman probe method. Background technique [0002] Tilletia controversa Kühn (TCK for short) caused by Tilletia controversa Kühn (TCK) is an important international quarantine disease, which causes serious damage to wheat production and is also one of the main species of foreign biological invasion research in my country. One (Wang Yuan, 1997). In its popular year, the yield loss caused by wheat dwarf smut is generally 20% to 50%, and in severe cases it can reach 75% to 90%, or even extinction. The bacteria are highly resistant to stress, and their teliospores can survive in the soil for 3 to 7 years, and the teliospores wrapped in the galls can even maintain their vitality for more than 10 years. Once this disease occurs, it is difficult to control or eradicate it, so 15 countries in the world have listed it as...

AI Technical Summary

Problems solved by technology

In 2004, Gao Qiang used RAPD technology to find a band that could distinguish Tilletia tritici and T. dwarf from other smut strains. No different bands were found between the bacteria, and the two could not be separated

However, the inventors found that the marker primers and PCR method in this patent could not be well applied to the early warning of wheat dwarf smut and the screening of TCK-resistant wheat varieties, probably because the extracted After DNA, the proportion of DNA in TCK is too small, that is, the concentration is too low, and the sensitivity of ordinary PCR is not enough to detect such a low concentration of templates

As we all know, real-time quantitative PCR is significantly superior to ordinary PCR in terms of sensitivity, so the inventors tried to use the Scar-labeled primers in this patent to amplify TCK samples in real-time quantitative PCR, but whether in real-time fluorescent quantitative methods or in TaqMan hydrolysis In the quantitative PCR by probe method, from the amplification curves of different gradients, the standard curve and the melting curve, the specificity of the primers is not good, and the amplification efficiency of the standard curve is much higher than the normal efficiency of 90-110%, so the primers Problems with Template Amplification

Images