LAMP-and-molecular-beacon-based reaction system and method for detecting HPV16 and HPV18

A reaction system and molecular beacon technology, applied in the field of molecular biology detection, can solve the problems of inability to distinguish positive amplification results from false positive results, inconvenience of clinical detection, etc., and achieve the effect of technical sensitivity

Inactive Publication Date: 2015-07-29
赣南医学院第一附属医院 +1
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The biggest problem with the clinical application of LAMP technology is that traditional LAMP technology mostly uses methods such as observing the white precipitate of magnesium pyrophosphate, the color of HNB dye, and calcein fluorescence to judge positive results, but the positive detection results of the above methods can only represent the occurrence of LAMP during the experiment. During the reaction process, it is impossible to distinguish the positive amplification result formed by the hybridization of the primer and the corresponding target DNA template from the false positive result caused by the false amplification caused by the mishybridization between the primers and between the primer and the sample DNA. Inconvenience caused by detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP-and-molecular-beacon-based reaction system and method for detecting HPV16 and HPV18
  • LAMP-and-molecular-beacon-based reaction system and method for detecting HPV16 and HPV18
  • LAMP-and-molecular-beacon-based reaction system and method for detecting HPV16 and HPV18

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Reaction system and method for detecting HPV16 and 18 based on LAMP and molecular beacons

[0047]Select the conserved sequences of HPV16 and HPV18 to design corresponding LAMP primers, including two outer primers (F3, B3) and two inner primers (FIP, BIP), and corresponding molecular beacon probes (MB-16, MB-18 ). Primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. and purified by HPLC.

[0048] The reaction system includes a primer set for detecting HPV16 and HPV18, specifically including the following components:

[0049] The reaction system includes the following components:

[0050]

[0051]

[0052] The sequences are as follows:

[0053] CATGGAGATACACCTACATTG (SEQ ID NO.1)

[0054] GTACGGATGTCTACGTGTG (SEQ ID NO. 2)

[0055] CTCTGAGCTGTCATTTAATTGCTCAGAATATATGTTAGATTTGCAACCAG (SEQ ID NO. 3)

[0056] GGACAAGCAGAACCGGACAGCGAAGCGTAGAGTCACAC (SEQ ID NO. 4)

[0057] CGCGAGACGAAATAGATGGTCCAGTCGCG (SEQ ID NO. 5)

[0058] ACAAATGTC...

Embodiment 2

[0071] Embodiment 2 Sensitivity detection of the detection method of embodiment 1

[0072] Use HPV16, type 18 primers F3 (SEQ.ID.NO.1 and SEQ.ID.NO.6), B3 (SEQ.ID.NO.2 and SEQ.ID.NO.7) to amplify positive sample DNA respectively , Insert the amplified fragment into the T vector and verify it by sequencing, then quantitatively measure the OD260 / 280 value with a spectrophotometer, and then dilute the amplified plasmid to 10 with deionized water or TEBuffer 1 -10 10 Copy / ul as standard. Standards with different concentrations were detected by LAMP, and the reaction system and reaction conditions were the same as in Example 1.

[0073] After the LAMP reaction, use a PCR instrument or a temperature-controlled metal bath to control the temperature at 4°C, 65°C, and 95°C, respectively, and irradiate the reaction tube with a hand-held ultraviolet lamp to observe the fluorescence. At this time, the negative tube shows a change from no fluorescence to weak fluorescence to strong fluo...

Embodiment 3

[0075] Embodiment 3 The specific detection of the detection method of embodiment 1

[0076] Select DNA samples that have been clinically determined by PCR-reverse dot hybridization to determine the subtype of HPV infection, including 16, 18, 52, 68, and 33 positive samples, and use Axygen’s bacterial genome DNA extraction kit to extract the DNA of the samples to be tested. 20 ng of DNA (about 3000 copies of human genomic DNA) from each sample to be tested was taken as a template for LAMP detection, and the reaction system and reaction conditions were the same as in Example 1.

[0077] Comparison method: select DNA samples that have been confirmed by PCR-reverse dot hybridization in clinical practice, including positive samples of types 16, 18, 52, 68, and 33, and use Axygen’s bacterial genomic DNA extraction kit to extract samples to be tested Take 20ng of the DNA of the sample to be tested (about 3000 copies of human genomic DNA) as a template for LAMP detection. The reaction...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (Loop-mediated Isothermal Amplification)-and-molecular-beacon-based reaction system and method for detecting HPV16 and HPV18. The reaction system comprises outer primers, inner primers and molecular beacon probes MB-16 and MB-18, which are all used for detecting HPV16 and HPV18. According to the method for detecting HPV16 and HPV18, HPV pathogens are detected on the basis of the LAMP and molecular beacon technology; on the basis of the traditional LAMP technology, LAMP amplified products are detected by virtue of the intensity difference of fluorescence emitted by the molecular beacon probes at different temperatures; compared with the traditional LAMP technology, a false positive result caused by self-hybridization of the primers in the traditional LAMP technology is avoided; the advantages of strong specificity and simple operation are achieved.

Description

technical field [0001] The invention belongs to the technical field of molecular biology detection, and more specifically, the invention relates to a reaction system and a detection method for detecting human papillomavirus types 16 and 18 based on LAMP and molecular beacons. Background technique [0002] Cervical cancer is the most serious disease threatening women's health in the world. In 2008, there were 529,800 new cervical cancer cases and 255,100 deaths worldwide, of which 85% were in developing countries. Persistent infection of high-risk human papillomaviruses (human papillomaviruses, HPV) is the main cause of cervical cancer and its precancerous lesions. 100% of cervical cancer patients carry high-risk HPV infection, about 97% of patients with high-grade lesions (CIN2 or CIN3) are HPV-positive, and the positive rate of low-grade lesions (CIN1) also reaches 61.4%. Common high-risk HPV types are: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, 82, etc. [0...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6853C12Q1/708
Inventor钟田雨黄劭
Owner赣南医学院第一附属医院