Primers, kit and pcr method for detecting d842v polymorphic site of pdgfra gene
A technology of polymorphic sites and kits, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of inability to detect clinical specimens on a large scale at the same time, low clinical popularity, and the price of testing instruments Advanced problems, to achieve the effect of avoiding site mismatch, fast detection speed and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0120] Example 1: Preparation of wild-type and mutant positive plasmids for PDGFRA gene D842V polymorphic site detection
[0121] First, we called out the gene sequence before and after the D842V polymorphic site of the PDGFRA gene from the gene bank, and marked the polymorphic site with a double underline, and placed it at the appropriate position upstream and downstream of the D842V polymorphic site of the PDGFRA gene (in bold word and underline), design a pair of cloning primers, the amplified fragment is 120bp, including the mutation site, the gene sequence is shown below, SEQ No.1:
[0122] agctacagatggcttgatcctgagtcatttcttccttttccatgcagtgtgt ccaccgtgatctggctgctc gcaacgtcctcctggcacaaggaaaaattgtgaagatctgtgactttggcctggccagag a catcatgcatgattc gaacta tgtgtcgaaaggcagtgt acgtcctcacttccctcactggtcaggctcatcctccttcactttaatctctaaagtcaggtgttgcttctagagattcggtgcctgttttttaaaacatcaatagattt
[0123] The experimental steps are as follows:
[0124] 1) Genomic DNA extraction
[012...
Embodiment 2
[0138] Example 2: Design and specificity screening of allele-specific primers (ASP)
[0139] Aiming at the D842V polymorphic site of PDGFRA gene, wild-type and a series of mutation-specific primers were designed as follows:
[0140] PDGFRA-D842V-WT-R: cacatagttcgaatcatgcatgaagt (SEQ No. 8)
[0141] PDGFRA-D842V-mut-R: cacatagttcgaatcatgcatgaaga (SEQ No. 9)
[0142] PDGFRA-D842V-mut-R1: acatagttcgaatcatgcatgaaga (SEQ No. 10)
[0143] PDGFRA-D842V-mut-R2: catagttcgaatcatgcatgaaga (SEQ No. 11)
[0144] PDGFRA-D842V-mut-R3: cacatagttcgaatcatgcatgatca (SEQ No. 12)
[0145] PDGFRA-D842V-mut-R4: acatagttcgaatcatgcatgatca (SEQ No. 13)
[0146] PDGFRA-D842V-mut-R5: catagttcgaatcatgcatgatca (SEQ No. 14)
[0147] Simultaneously design and synthesize Taqman-specific probes:
[0148] SEQ No.15: FAM-ccaggccaaagtcacagatcttcacaat-BHQ1, related primers and probes were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0149] Then use the above 7 primers to pair with the PDGFRA-D8...
Embodiment 3
[0151] Embodiment 3: ASP sensitivity screening
[0152] Then use the mutant primers to pair with the common downstream primer SEQ No.16 of the PDGFRA gene D842V polymorphic site, and use the mutant recombinant plasmid according to 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 0 for serial dilution, plus Taqman-specific probes, sensitivity verification was performed on a fluorescent quantitative PCR instrument. Mutation-specific primers can detect 100 copies of mutants, so this primer is the best primer for detecting the D842V polymorphism site of PDGFRA gene screened according to our method, as shown in Table 3.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



