Metagenome-derived beta-mannanase, and encoding gene and expression thereof

An amino acid, glycosidic bond technology, applied in genetic engineering, plant genetic improvement, enzymes, etc., can solve problems such as high production cost, difficulty in obtaining competitive advantages, and unstable composition of fermentation enzymatic hydrolysis products.

Active Publication Date: 2015-09-02
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research of relevant domestic scientific research institutes is mostly limited to the laboratory stage, and the composition of the reported fermentation enzyme hydrolyzate is unstable, and the production cost is high, so it is difficult to obtain a competitive advantage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Metagenome-derived beta-mannanase, and encoding gene and expression thereof
  • Metagenome-derived beta-mannanase, and encoding gene and expression thereof
  • Metagenome-derived beta-mannanase, and encoding gene and expression thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102] Example 1. Obtaining β-mannanase ManI and its coding gene

[0103] 1. Establish the metagenome Fosmid library of the anaerobic biogas slurry fermentation system

[0104] 1.1 Extract anaerobic fermentation large fragment metagenomic DNA according to the following method

[0105] Take 8ml biogas slurry, centrifuge, take the precipitate and use 20ml PBS buffer (137mmol l -1 NaCl, 2.7mmol l -1 KCl, 1.5mmol l -1 KH 2 PO 4 , 8.1mmol l -1 Na 2 HPO 4 , PH7.4) Wash 3 times.

[0106] The precipitate was resuspended in 7.68ml DNA extraction buffer (100mM Tris-HCl[pH8.0], 100mM EDTA, 100mM Na 3 PO 4 , 1.5M NaCl, 1% (w / v) CTAB), add proteinase K (final concentration 1mg / ml) and SDS (final concentration 1% (w / v)), incubate at 55°C for 20 minutes and then at 70°C for 10 minutes . After the crude lysate was centrifuged at 17,000 g for 10 min, the supernatant was collected. The supernatant was extracted twice with phenol:chloroform:isoamyl alcohol (25:24:1) and then the supernatant was extrac...

Embodiment 2

[0124] Example 2. Expression of man1 in E. coli

[0125] 1. Construction of recombinant expression vector in host Escherichia coli

[0126] The ORF coding gene of mannanase gene man1 (SEQ ID NO: 1, encoding the polypeptide shown in SEQ ID NO: 3) was cloned by PCR using biogas slurry DNA or Fosmid DNA as a template. The forward primer used was: 5’CCG GAATTC ATGGCTGGTGAACGTATAAGAATC3' (SEQ ID NO: 6), with EcoRI recognition site added to its 5'end: GAATTC ; Reverse primer is 5’CCG CTCGAG AGAAGGCTCTCCTTGCGACTTCCTT3' (SEQ ID NO: 7), with Xho I recognition site added to its 5'end: CTCGAG .

[0127] The PCR product was purified and then digested with Cla I and Xba I. Axygen PCR product column recovery kit was used to recover the digested DNA fragment. The DNA fragment and the vector pET28 recovered after the same double digestion were used with T4 DNA ligase Ligated overnight at 16°C to obtain the recombinant expression vector pET28a-ecoman1. The N and C ends of the expression produc...

Embodiment 3

[0135] Example 3. Analysis of protease properties of recombinant ManI

[0136] The determination of the enzyme activity of mannanase adopts DNS method, the specific operation is as follows:

[0137] (1) DNS configuration

[0138] Weigh 10 grams of NaOH and dissolve in about 400ml ddH 2 In O, weigh 10g dinitrosalicylic acid, 2g phenol, 0.5g anhydrous sodium sulfite, 200g potassium sodium tartrate tetrahydrate, and dissolve it in about 300ml ddH 2 In O, mix the two solutions, dilute to 1 liter, and store in the dark.

[0139] (2) Standard curve preparation

[0140] Take 9 thin-walled centrifuge tubes and add the solution according to Table 3.

[0141] table 3

[0142] Standard sample number

1

2

3

4

5

6

7

Total mannose (μg)

0

10

20

30

40

50

60

Mannose volume (μl)

0

1

2

3

4

5

6

Supplement with pure water (μl)

100

99

98

97

96

95

94

[0143] The mannose concentration is 10mg / ml. Add 100μl of DNS to each standard sample in the above table, and develop color in a boiling water bath fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a metagenome-derived beta-mannanase, and an encoding gene and an expression thereof. A beta-mannanase gene is cloned from a biogas slurry metagenome library by the inventor, a protein encoding the gene can well hydrolyze a glycosidic bond in an incision mode, and the gene can be highly expressed in various hosts. The beta-mannanase has good stability and high activity under neutral-weak acidic conditions, and can be well applied in industrial production.

Description

Technical field [0001] The present invention belongs to the field of biotechnology; more specifically, the present invention relates to a fungal-derived β-mannanase, its coding gene and its efficient heterologous expression. Background technique [0002] β-mannanase (mannan endo-β-1,4-mannosidase; EC3.2.1.78) is a class of degrading mannan, glucomannan, galactomannan and galactomannan The main chain β-1,4-D-mannopyranoside bond enzyme, which belongs to a kind of hemicellulase, has a wide range of uses. At home and abroad, it is mainly used in paper pulp bleaching, oil well degumming, degrading vegetable gum to produce oligosaccharides as growth-promoting factors for bifidobacteria, as health foods for disease prevention and aging, and as anti-nutritional factors in the feed industry. [0003] Introduction to β-mannanase. β-mannanase is a hemicellulose hydrolase, which degrades β-1,4-glycosidic bonds in an endoscopic manner, and the non-reducing end of the degradation product is m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/15C12P19/14A23K1/165A23L1/305
Inventor 周志华邹根魏勇军严兴
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap