Metagenome-derived beta-mannanase, and encoding gene and expression thereof
An amino acid, glycosidic bond technology, applied in genetic engineering, plant genetic improvement, enzymes, etc., can solve problems such as high production cost, difficulty in obtaining competitive advantages, and unstable composition of fermentation enzymatic hydrolysis products.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2015-09-02
Smart Images
Figure 1 Figure 2 Figure 3
Abstract
Description
Technical field
[0001] The present invention belongs to the field of biotechnology; more specifically, the present invention relates to a fungal-derived β-mannanase, its coding gene and its efficient heterologous expression. Background technique
[0002] β-mannanase (mannan endo-β-1,4-mannosidase; EC3.2.1.78) is a class of degrading mannan, glucomannan, galactomannan and galactomannan The main chain β-1,4-D-mannopyranoside bond enzyme, which belongs to a kind of hemicellulase, has a wide range of uses. At home and abroad, it is mainly used in paper pulp bleaching, oil well degumming, degrading vegetable gum to produce oligosaccharides as growth-promoting factors for bifidobacteria, as health foods for disease prevention and aging, and as anti-nutritional factors in the feed industry.
[0003] Introduction to β-mannanase. β-mannanase is a hemicellulose hydrolase, which degrades β-1,4-glycosidic bonds in an endoscopic manner, and the non-reducing end of the degradation product is m...
Examples
Embodiment 1
[0102] Example 1. Obtaining β-mannanase ManI and its coding gene
[0103] 1. Establish the metagenome Fosmid library of the anaerobic biogas slurry fermentation system
[0104] 1.1 Extract anaerobic fermentation large fragment metagenomic DNA according to the following method
[0105] Take 8ml biogas slurry, centrifuge, take the precipitate and use 20ml PBS buffer (137mmol l -1 NaCl, 2.7mmol l -1 KCl, 1.5mmol l -1 KH 2 PO 4 , 8.1mmol l -1 Na 2 HPO 4 , PH7.4) Wash 3 times.
[0106] The precipitate was resuspended in 7.68ml DNA extraction buffer (100mM Tris-HCl[pH8.0], 100mM EDTA, 100mM Na 3 PO 4 , 1.5M NaCl, 1% (w / v) CTAB), add proteinase K (final concentration 1mg / ml) and SDS (final concentration 1% (w / v)), incubate at 55°C for 20 minutes and then at 70°C for 10 minutes . After the crude lysate was centrifuged at 17,000 g for 10 min, the supernatant was collected. The supernatant was extracted twice with phenol:chloroform:isoamyl alcohol (25:24:1) and then the supernatant was extrac...
Embodiment 2
[0124] Example 2. Expression of man1 in E. coli
[0125] 1. Construction of recombinant expression vector in host Escherichia coli
[0126] The ORF coding gene of mannanase gene man1 (SEQ ID NO: 1, encoding the polypeptide shown in SEQ ID NO: 3) was cloned by PCR using biogas slurry DNA or Fosmid DNA as a template. The forward primer used was: 5’CCG GAATTC ATGGCTGGTGAACGTATAAGAATC3' (SEQ ID NO: 6), with EcoRI recognition site added to its 5'end: GAATTC ; Reverse primer is 5’CCG CTCGAG AGAAGGCTCTCCTTGCGACTTCCTT3' (SEQ ID NO: 7), with Xho I recognition site added to its 5'end: CTCGAG .
[0127] The PCR product was purified and then digested with Cla I and Xba I. Axygen PCR product column recovery kit was used to recover the digested DNA fragment. The DNA fragment and the vector pET28 recovered after the same double digestion were used with T4 DNA ligase Ligated overnight at 16°C to obtain the recombinant expression vector pET28a-ecoman1. The N and C ends of the expression produc...
Embodiment 3
[0135] Example 3. Analysis of protease properties of recombinant ManI
[0136] The determination of the enzyme activity of mannanase adopts DNS method, the specific operation is as follows:
[0137] (1) DNS configuration
[0138] Weigh 10 grams of NaOH and dissolve in about 400ml ddH 2 In O, weigh 10g dinitrosalicylic acid, 2g phenol, 0.5g anhydrous sodium sulfite, 200g potassium sodium tartrate tetrahydrate, and dissolve it in about 300ml ddH 2 In O, mix the two solutions, dilute to 1 liter, and store in the dark.
[0139] (2) Standard curve preparation
[0140] Take 9 thin-walled centrifuge tubes and add the solution according to Table 3.
[0141] table 3
[0142] Standard sample number
1
2
3
4
5
6
7
Total mannose (μg)
0
10
20
30
40
50
60
Mannose volume (μl)
0
1
2
3
4
5
6
Supplement with pure water (μl)
100
99
98
97
96
95
94
[0143] The mannose concentration is 10mg / ml. Add 100μl of DNS to each standard sample in the above table, and develop color in a boiling water bath fo...