Application of nucleic acid aptamers in identifying and being bound with integrin alpha4

A nucleic acid aptamer and integrin technology, applied in the fields of biotechnology and clinical medicine, to achieve the effect of strong specificity and high affinity

Active Publication Date: 2015-10-21
INST OF CHEM CHINESE ACAD OF SCI
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are only a few successful examples so far, and the bottleneck problem lies in the purification / identification of nucleic acid aptamer target molecules located on the cell membrane

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of nucleic acid aptamers in identifying and being bound with integrin alpha4
  • Application of nucleic acid aptamers in identifying and being bound with integrin alpha4
  • Application of nucleic acid aptamers in identifying and being bound with integrin alpha4

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1. Identification of nucleic acid aptamer Sgc-4e that specifically recognizes and binds to integrin α4

[0065] 1. Preparation of nucleic acid aptamer Sgc-4e and its derivatives

[0066] 1. Synthesis of nucleic acid aptamer Sgc-4e

[0067] Synthesize nucleic acid adapter Sgc-4e by DNA synthesizer, the nucleotide sequence of nucleic acid adapter Sgc-4e is as follows: 5'-TCACTTATTCAATTCGAGTGCGGATGCAAACGCCAGACAGGGGGACAGGAGA TAAGTGA-3' (sequence 1); The 5' end or 3' end of Sgc-4e is labeled with different molecules (such as biotin and fluorescein, etc.) to obtain derivatives of the nucleic acid aptamer Sgc-4e.

[0068] 2. DNA deprotection

[0069] After deprotection with cold ammonia, the DNA was then dissolved in TEAA solution.

[0070] 3. DNA purification

[0071] Purify by PAGE or HPLC.

[0072] 4. DNA drying

[0073] Concentrate to dryness by centrifugation.

[0074] 5. Dissolve and measure the concentration for later use.

[0075] 2. Identification of n...

Embodiment 2

[0143] Example 2. Application of the nucleic acid aptamer Sgc-4e in determining the expression of integrin α4 in different types of cells

[0144] In order to clarify the expression of integrin α4 (NP_000876) in different cells by nucleic acid aptamer Sgc-4e, the fluorescently labeled nucleic acid aptamer Sgc-4e and anti-integrin α4 antibody were used to measure the expression of different cells by flow cytometry. The expression of integrin α4 in cells was measured. Specific steps are as follows:

[0145] 1. Preparation of fluorescein-labeled aptamer Sgc-4e solution (Sgc-4e-FAM)

[0146] The fluorescein-labeled nucleic acid aptamer Sgc-4e was obtained by coupling the fluorescein group to the 5' end of the nucleic acid aptamer Sgc-4e. Sgc-4e-FAM was dissolved in binding buffer, and the concentration was calibrated according to the ultraviolet absorption ( 100nM), heated at 95°C for 5min, placed on ice for 5min, and placed at room temperature for 15min.

[0147] 2. Pretreatme...

Embodiment 3

[0156] Example 3. Effects of divalent ions on the binding of nucleic acid aptamer Sgc-4e to integrin α4

[0157] The activity of integrin α4 is affected by divalent ions (especially Mg 2+ , Ca 2+ or Mn 2+ ) regulation, in order to prove that the nucleic acid aptamer Sgc-4e can bind to the active integrin α4, the effect of divalent ions on the binding of the nucleic acid aptamer Sgc-4e to the integrin α4 was studied.

[0158] 1. Preparation of fluorescein-labeled aptamer Sgc-4e solution (Sgc-4e-FAM)

[0159] The fluorescein-labeled nucleic acid aptamer Sgc-4e is obtained by coupling the fluorescein group to the 5' end of the nucleic acid aptamer Sgc-4e. The Sgc-4e-FAM is dissolved in the binding buffer, and the concentration is calibrated according to the ultraviolet absorption. After 100nM, heat at 95°C for 5min, place on ice for 5min, and place at room temperature for 15min.

[0160] 2. Treat the above-mentioned Jurkat E6-1 cells according to the following five groups:

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of nucleic acid aptamers in identifying and being bound with integrin alpha4. According to the application of the nucleic acid aptamers in identifying and being bound with the integrin alpha4, it is initiatively found that the nucleic acid aptamers Sgc-4e can identify and be bound with the integrin alpha4 in a specific mode, and the specific binding effect of the nucleic acid aptamers Sgc-4e and the integrin alpha4 is utilized for establishing a method for detecting the integrin alpha4. Experimental results show that the nucleic acid aptamers Sgc-4e have the advtanges of being high in affinity, great in specificity, free of immunogenicity and toxicity and the like, and by means of the method for detecting the integrin alpha4 which is established based on the nucleic acid aptamers Sgc-4e, a new strategy for treating multiple sclerosis can be provided.

Description

technical field [0001] The invention belongs to the technical field of biotechnology and clinical medicine, and specifically relates to the application of nucleic acid aptamers in recognizing and binding integrin α4. Background technique [0002] Nucleic acid aptamer (aptamer) is a kind of single-stranded DNA, RNA, peptide nucleic acid or chemically modified nucleic acid sequence that can specifically interact with the target substance, usually consisting of 15-80 nucleotides. Nucleic acid aptamers can form specific three-dimensional structures and bind to target molecules with high affinity, such as hairpins, pseudoknots, G-quadruplexes and other structures. Highly specific binding is through van der Waals forces, hydrogen bonds, electrostatic interactions, and hydrophobic interactions. achieved by intermolecular interactions. It has the characteristics of high affinity, good specificity, non-immunogenicity, easy synthesis, transformation and modification, good biochemical...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/115C12Q1/68G01N33/68A61K48/00A61P25/00
Inventor上官棣华邴涛汪寅生刘祥军
OwnerINST OF CHEM CHINESE ACAD OF SCI