Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for identifying or assisting in identifying linolenic acid content of soybean seeds and application thereof

An auxiliary identification, linolenic acid technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc.

Active Publication Date: 2015-10-28
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Since the content of linolenic acid is a quantitative trait controlled by multiple genes and is easily affected by the environment, it takes a long time to breed varieties with high linolenic acid content using traditional phenotypic identification and breeding methods, and it is difficult to succeed. Development of High Quality Soybean Breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying or assisting in identifying linolenic acid content of soybean seeds and application thereof
  • Method for identifying or assisting in identifying linolenic acid content of soybean seeds and application thereof
  • Method for identifying or assisting in identifying linolenic acid content of soybean seeds and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1. The Map-6017 SNP site is a single nucleotide polymorphism related to the linolenic acid content of soybean grains

[0046] 1. Basic information of Map-6017 SNP sites

[0047] The Map-6017 SNP site is located at position 3230 in the nucleotide sequence of Glyma.02G138100 gene (sequence 1), and its basic information is shown in Table 1.

[0048] Table 1. Basic information of Map-6017SNP SNP sites

[0049]

[0050] 2. Correlation analysis between Map-6017SNP genotype and linolenic acid content in soybean grains

[0051] 1. Preparation of Map-6017SNP probe set

[0052] According to the self-developed genome-wide SNP data set, the Map-6017SNP loci were screened and the Map-6017SNP probe set was artificially synthesized:

[0053] Probe 1: ACTTCGTCAGTAACGGACGGATTCTTGGCGGCAGCCCA (sequence 2 in the sequence list);

[0054] Probe 2: GAGTCGAGGTCATATCGTGGATTCTTGGCGGCAGCCCG (sequence 3 in the sequence list);

[0055] Probe 3: AAATGTATTCTTGAGCCTTTCTTTGGACCAGAGCACGGGTAGTTTGTCTGCCTATAGTGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying or assisting in identifying the linolenic acid content of soybean seeds and application thereof. The method for identifying or assisting in identifying the linolenic acid content in the soybean seeds includes the following step that the genotype, based on the Map-6017 SNP locus, in a soybean genome to be detected is detected, if the genotype is a TT homozygotic type, the soybean seeds to be detected are candidate soybean seeds with characters of the high linolenic acid content, and if the genotype is a CC homozygotic type, the soybean seeds to be detected are candidate soybean seeds with characters of the low linolenic acid content; the high linolenic acid content means that the linolenic acid content is over 8.5%, and the low linolenic acid content means that the linolenic acid content is smaller than 8.5%. Experiments show that the method for identifying or assisting in identifying the characters of the linolenic acid content of the soybean seeds can be used for identifying or assisting in identifying the linolenic acid content of soybean varieties to be detected.

Description

Technical field [0001] The invention relates to the field of biotechnology, in particular to a method for identifying or assisting in identifying the content of linolenic acid in soybean grains and its application. Background technique [0002] Soybean (Glycine max) is an important oil-bearing food crop in the world, and its seed oil is an important source of human and animal nutrition and vegetable edible oil in the food processing industry. Soybean oil accounts for 31% of the world's edible oil (Kim and Krishnan, 2004). Soybean seed oil is mainly composed of glycerin and fatty acids, of which fatty acids account for more than 90% of the seed oil, mainly including palmitic acid (16:0) and stearic acid (18:0) two saturated fatty acids and oleic acid (18: 1) Three kinds of unsaturated fatty acids such as linoleic acid (18:2) and linolenic acid (18:3). The composition of fatty acids and their type ratio determine the quality of seed oil. Linolenic acid is an essential fatty acid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 邱丽娟李英慧
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com