A method for identifying or assisting the identification of soybean grain linolenic acid content and its application

A technology for auxiliary identification and linolenic acid, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems that cannot meet the development of high-quality soybean breeding, are difficult to succeed, and are easily affected by the environment, etc. question

Active Publication Date: 2018-04-13
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Since the content of linolenic acid is a quantitative trait controlled by multiple genes and is easily affected by the environment, it takes a long time to breed varieties with high linolenic acid content using traditional phenotypic identification and breeding methods, and it is difficult to succeed. Development of High Quality Soybean Breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for identifying or assisting the identification of soybean grain linolenic acid content and its application
  • A method for identifying or assisting the identification of soybean grain linolenic acid content and its application
  • A method for identifying or assisting the identification of soybean grain linolenic acid content and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1, Map-6017SNP site is a single nucleotide polymorphism related to soybean grain linolenic acid content

[0046] 1. Basic information of Map-6017 single nucleotide polymorphism sites

[0047] The Map-6017 single nucleotide polymorphism site is located at the 3230th position of the nucleotide sequence (sequence 1) of the Glyma.02G138100 gene, and its basic information is shown in Table 1.

[0048] Table 1. Basic information of Map-6017SNP single nucleotide polymorphism site

[0049]

[0050] 2. Association analysis between Map-6017SNP genotype and linolenic acid content in soybean grains

[0051] 1. Preparation of Map-6017SNP probe set

[0052] According to the self-developed genome-wide SNP data set, the Map-6017SNP site was screened and the Map-6017SNP probe set was artificially synthesized:

[0053] Probe 1: ACTTCGTCAGTAACGGACGGATTCTTGGCGGCAGCCCA (SEQ ID NO: 2 in the sequence listing);

[0054] Probe 2: GAGTCGAGGTCATATCGTGGATTCTTGGCGGCAGCCCG (SEQUE 3 in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for identifying or assisting in identifying the linolenic acid content of soybean seeds and application thereof. The method for identifying or assisting in identifying the linolenic acid content in the soybean seeds includes the following step that the genotype, based on the Map-6017 SNP locus, in a soybean genome to be detected is detected, if the genotype is a TT homozygotic type, the soybean seeds to be detected are candidate soybean seeds with characters of the high linolenic acid content, and if the genotype is a CC homozygotic type, the soybean seeds to be detected are candidate soybean seeds with characters of the low linolenic acid content; the high linolenic acid content means that the linolenic acid content is over 8.5%, and the low linolenic acid content means that the linolenic acid content is smaller than 8.5%. Experiments show that the method for identifying or assisting in identifying the characters of the linolenic acid content of the soybean seeds can be used for identifying or assisting in identifying the linolenic acid content of soybean varieties to be detected.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for identifying or assisting in identifying the linolenic acid content of soybean grains and its application. Background technique [0002] Soybean (Glycine max) is an important oil-bearing food crop in the world, and its seed oil is an important source of vegetable oil for human and animal nutrition and food processing industry. Soybean oil accounts for 31% of the world's edible oil (Kim and Krishnan, 2004). Soybean seed oil is mainly composed of glycerol and fatty acids, of which fatty acids account for more than 90% of the seed oil, mainly including palmitic acid (16:0) and stearic acid (18:0) two saturated fatty acids and oleic acid (18:0) 1), three unsaturated fatty acids such as linoleic acid (18:2) and linolenic acid (18:3). The composition and type ratio of fatty acids determine the quality of seed oil. Linolenic acid is an essential fatty acid for the human body....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 邱丽娟李英慧
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap