A method for identifying or assisting the identification of soybean grain linolenic acid content and its application
A technology for auxiliary identification and linolenic acid, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problems that cannot meet the development of high-quality soybean breeding, are difficult to succeed, and are easily affected by the environment, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1, Map-6017SNP site is a single nucleotide polymorphism related to soybean grain linolenic acid content
[0046] 1. Basic information of Map-6017 single nucleotide polymorphism sites
[0047] The Map-6017 single nucleotide polymorphism site is located at the 3230th position of the nucleotide sequence (sequence 1) of the Glyma.02G138100 gene, and its basic information is shown in Table 1.
[0048] Table 1. Basic information of Map-6017SNP single nucleotide polymorphism site
[0049]
[0050] 2. Association analysis between Map-6017SNP genotype and linolenic acid content in soybean grains
[0051] 1. Preparation of Map-6017SNP probe set
[0052] According to the self-developed genome-wide SNP data set, the Map-6017SNP site was screened and the Map-6017SNP probe set was artificially synthesized:
[0053] Probe 1: ACTTCGTCAGTAACGGACGGATTCTTGGCGGCAGCCCA (SEQ ID NO: 2 in the sequence listing);
[0054] Probe 2: GAGTCGAGGTCATATCGTGGATTCTTGGCGGCAGCCCG (SEQUE 3 in...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap