ShRNA molecular sequence for suppressing expression of chicken cyclin F genes and application thereof
A cell cycle and gene expression technology, applied in the field of RNA interference sequences, can solve problems such as RNA interference sequences for which there is no cyclin F gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1. Design and synthesis of shRNA sequences that interfere with chicken cyclin F gene, construction of interference vectors, and virus collection.
[0022] Design and chemically synthesize five shRNA molecules according to the chicken cyclin F gene mRNA nucleotide sequence published by NCBI, the sequences are as follows:
[0023] The first line (shRNA-462): target gene 462-482 bases (GCAGAAGTGAATGGATTAAAG) 5'-GCAGAAGTGAATGGATTAAAG-TTCAAGAGA-CTTTAATCCATTCACTTCTGCTT-3' (sequence 1);
[0024] The second line (shRNA-623): target gene 623-643 bases (GCTGGACAAAGCTCAGAAAGG) 5'-GCTGGACAAAGCTCAGAAAGG-TTCAAGAGA-CCTTTCTGAGCTTTGTCCAGCTT-3' (sequence 2);
[0025] The third line (shRNA-938): target gene 938-958 bases (GGTGGCTCAGATGTTTCAAGC) 5'-GGTGGCTCAGATGTTTCAAGC-TTCAAGAGAG-CTTGAAACATCTGAGCCACCTT-3' (sequence 3);
[0026] The fourth line (shRNA-1817): target gene 1817-1837 bases (GGAAGACAGCACTCAGGATGA) 5'-GGAAGACAGCACTCAGGATGA-TTCAAGAGA-TCATCCTGAGTGCTGTCTTCCTT-3' (sequence ...
Embodiment 2
[0030] Example 2, the expression level of cyclin F gene after infection of chicken embryo testis Sertoli cells by virus particles obtained by shRNA lentivirus interference vector
[0031] The virus particles obtained by the five shRNA lentivirus interference vectors prepared in Example 1 were used to infect the Sertoli cells of chicken embryo testis, and the specific steps were as follows:
[0032] 1. Take the eggs that have been hatched for 18 days, and wash them with bromogeramine and 75% alcohol in turn;
[0033] 2. Aseptically obtain the testis, rinse it in PBS for 3 times, peel off the blood streaks and white membrane of the testis under a stereo microscope, wash it twice in PBS, transfer it into a vial and cut it into pieces;
[0034] 3. Add 1 mg / mL collagenase, put it in a 37°C incubator for 10 minutes, and shake once in the middle;
[0035] 4. Centrifuge at 1000 g for 7 minutes, discard the supernatant, add 0.25% trypsin-EDTA to digest until the liquid is turbid, suck...
Embodiment 3
[0043] Example 3, after the virus particles obtained by the shRNA lentivirus interference vector infected the chicken embryo fibroblast cell line (DF-1), the expression level of the cyclin F gene
[0044] The chicken fibroblast cell line (DF-1) was infected with the lentivirus of the high-efficiency interference carrier (shRNA-462) identified in Example 2, and the specific steps were as follows:
[0045] 1. Take out the DF-1 cells frozen in liquid nitrogen, dissolve them in a water bath at 37°C, centrifuge at 3000g for 3min, add 5mL of DMEM medium and blow the cells evenly, centrifuge at 1000g, add DMEM containing 10% FBS and blow evenly repeatedly. Single cell suspension at 5 x 10 5 Cells / mL were cultured in cell culture flasks, placed at 37°C, CO 2 cultured in an incubator.
[0046] 2. The day before transfection, press DF-1 at 1×10 4 Cells / mL were inoculated in 48-well plates, cultured to a good state, and the lentivirus infection was performed when the cell fusion rate ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com