Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ShRNA molecular sequence for suppressing expression of chicken cyclin F genes and application thereof

A cell cycle and gene expression technology, applied in the field of RNA interference sequences, can solve problems such as RNA interference sequences for which there is no cyclin F gene

Active Publication Date: 2015-11-11
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] After searching the literature of the prior art, it was found that there is no relevant report on the RNA interference sequence of the cyclin F gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ShRNA molecular sequence for suppressing expression of chicken cyclin F genes and application thereof
  • ShRNA molecular sequence for suppressing expression of chicken cyclin F genes and application thereof
  • ShRNA molecular sequence for suppressing expression of chicken cyclin F genes and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1. Design and synthesis of shRNA sequences that interfere with chicken cyclin F gene, construction of interference vectors, and virus collection.

[0022] Design and chemically synthesize five shRNA molecules according to the chicken cyclin F gene mRNA nucleotide sequence published by NCBI, the sequences are as follows:

[0023] The first line (shRNA-462): target gene 462-482 bases (GCAGAAGTGAATGGATTAAAG) 5'-GCAGAAGTGAATGGATTAAAG-TTCAAGAGA-CTTTAATCCATTCACTTCTGCTT-3' (sequence 1);

[0024] The second line (shRNA-623): target gene 623-643 bases (GCTGGACAAAGCTCAGAAAGG) 5'-GCTGGACAAAGCTCAGAAAGG-TTCAAGAGA-CCTTTCTGAGCTTTGTCCAGCTT-3' (sequence 2);

[0025] The third line (shRNA-938): target gene 938-958 bases (GGTGGCTCAGATGTTTCAAGC) 5'-GGTGGCTCAGATGTTTCAAGC-TTCAAGAGAG-CTTGAAACATCTGAGCCACCTT-3' (sequence 3);

[0026] The fourth line (shRNA-1817): target gene 1817-1837 bases (GGAAGACAGCACTCAGGATGA) 5'-GGAAGACAGCACTCAGGATGA-TTCAAGAGA-TCATCCTGAGTGCTGTCTTCCTT-3' (sequence ...

Embodiment 2

[0030] Example 2, the expression level of cyclin F gene after infection of chicken embryo testis Sertoli cells by virus particles obtained by shRNA lentivirus interference vector

[0031] The virus particles obtained by the five shRNA lentivirus interference vectors prepared in Example 1 were used to infect the Sertoli cells of chicken embryo testis, and the specific steps were as follows:

[0032] 1. Take the eggs that have been hatched for 18 days, and wash them with bromogeramine and 75% alcohol in turn;

[0033] 2. Aseptically obtain the testis, rinse it in PBS for 3 times, peel off the blood streaks and white membrane of the testis under a stereo microscope, wash it twice in PBS, transfer it into a vial and cut it into pieces;

[0034] 3. Add 1 mg / mL collagenase, put it in a 37°C incubator for 10 minutes, and shake once in the middle;

[0035] 4. Centrifuge at 1000 g for 7 minutes, discard the supernatant, add 0.25% trypsin-EDTA to digest until the liquid is turbid, suck...

Embodiment 3

[0043] Example 3, after the virus particles obtained by the shRNA lentivirus interference vector infected the chicken embryo fibroblast cell line (DF-1), the expression level of the cyclin F gene

[0044] The chicken fibroblast cell line (DF-1) was infected with the lentivirus of the high-efficiency interference carrier (shRNA-462) identified in Example 2, and the specific steps were as follows:

[0045] 1. Take out the DF-1 cells frozen in liquid nitrogen, dissolve them in a water bath at 37°C, centrifuge at 3000g for 3min, add 5mL of DMEM medium and blow the cells evenly, centrifuge at 1000g, add DMEM containing 10% FBS and blow evenly repeatedly. Single cell suspension at 5 x 10 5 Cells / mL were cultured in cell culture flasks, placed at 37°C, CO 2 cultured in an incubator.

[0046] 2. The day before transfection, press DF-1 at 1×10 4 Cells / mL were inoculated in 48-well plates, cultured to a good state, and the lentivirus infection was performed when the cell fusion rate ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a constructed shRNA lentiviral interference vector with the optimal efficiency for suppressing the expression of chicken cyclin F genes. Four shRNA sequences designed for the chicken cyclin F genes are copied into a lentiviral vector, four interference vectors are constructed, 293T cells are co-transfected through the four interference vectors and packaging plasmid, supernatant culture fluid is filtered to obtain virus suspension, chicken embryo fibroblast cell lines and chicken embryo testis sertoli cells are infected through a certain amount of MOI viruses after the virus titer is measured, and the shRNA interference vector with the optimal suppressing efficiency is screened. In the molecular biology, a real-time fluorescence quantification PCR proves that the shRNA interference vector effectively reduces the expression of the chicken cyclin F genes.

Description

technical field [0001] The invention relates to an RNA interference sequence in the field of gene technology, in particular to an shRNA molecular sequence for inhibiting the expression of chicken cyclin F gene. Background technique [0002] The cell cycle can usually be divided into four phases: G1, S, G2, and M, in which G1 and G2 phases are cell growth phases, S phase is the phase when cells replicate chromosomes in the nucleus; M phase is when cells undergo mitosis or meiosis period of division. Cell cyclins, also known as cyclins (Cyclin), are a family of proteins that are closely related to the functional state of the cell cycle. There are more than ten known cell cycle proteins. At present, the functions of more thorough research are mainly CyclinA, CyclinB, CyclinC, CyclinD and CyclinE, they activate cyclin-dependent protein kinase (CDK) through cyclinbox to play a role in different stages of the cell cycle. In 1994, Elledge laboratory discovered a new human cell cy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867A01K67/027
Inventor 孙研研陈继兰富丽薛夫光
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More