Unlock instant, AI-driven research and patent intelligence for your innovation.

Human NDRG4/TFPI2 gene methylation detection marker and reagent kit

A detection kit and methylation technology, which are applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problem of low diagnostic accuracy, low specificity and effectiveness, and insufficient early diagnosis of colorectal cancer. Mature, survival time less than 30 months and other issues, to achieve efficient clinical auxiliary diagnosis, high accuracy, increase accuracy and specificity

Inactive Publication Date: 2015-12-02
JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD +1
View PDF1 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And the average survival time of advanced colorectal cancer after chemoradiotherapy combined with molecular targeted therapy is still less than 30 months
[0007] At this stage, the use of PCR technology to detect DNA in patients' serum or feces and detect the concentration of microRNA has certain value for colorectal cancer treatment monitoring and prognosis evaluation, but it is still immature in the early diagnosis of colorectal cancer , the shortcomings of low diagnostic accuracy, specificity, and effectiveness have yet to be resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human NDRG4/TFPI2 gene methylation detection marker and reagent kit
  • Human NDRG4/TFPI2 gene methylation detection marker and reagent kit
  • Human NDRG4/TFPI2 gene methylation detection marker and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The present invention will be further described in detail below in conjunction with specific embodiments.

[0038] 1. Human NDRG4 / TFPI2 gene methylation quantitative detection system

[0039] Samples: human stool samples, positive quality control products, negative quality control products and standard products (the copy numbers of the plasmid are 100,000, 10,000, 1,000, 100 and 10 respectively);

[0040] Instruments: Lightcycler480, high-speed centrifuge, water bath, PCR instrument, vortex oscillator, ultra-clean workbench;

[0041] The capture primers for ACTB, NDRG4 and TFPI2 genes are as follows:

[0042] Capture probe

Sequence (5’-3’)

ACTB

/ 5AmMC6 / ACCCAGCACACAGTGGCAGACACAGGTTCACAGT

NDRG4

/ 5AmMC6 / TCCCTCGCGCGTGGCTTCCGCCTTCTGCGCGGCTGGGGTGCC

TFPI2

/ 5AmMC6 / CCTGGAGCAGAAAGCCGCGC

[0043] Note: / 5AmMC6 / means probe 5'terminal amino group + carbon 6 molecule

[0044] The methylation primers and probes of ACTB, NDRG4 and TFPI2 genes are as follows:

[0045] Primers, p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a human DNRG4 / TFPI2 gene methylation detection marker and a reagent kit. The human DNRG4 / TFPI2 gene methylation detection marker comprises capture primers, methylation primers and probes of three genes of ACTB, NDRG4 and TFPI2. The marker can be used for performing detection and auxiliary diagnosis on colorectal cancer and prediction and treatment effect evaluation on relapse and has the advantages of being high sensitivity and specificity and low in detection cost, materials are easy to get, and samples are easy to store.

Description

Technical field [0001] The invention relates to the field of biotechnology, in particular to a human NDRG4 / TFPI2 gene methylation detection marker and a kit. Background technique [0002] Colorectal cancer (CRC) is one of the common malignant tumors in clinical practice. The incidence and fatality rate of colorectal cancer are increasing worldwide, ranking second in the world. Clinical diagnosis and treatment practice shows that early colorectal cancer has no obvious clinical symptoms, but surgical treatment can radically cure early colorectal cancer. For patients with stage I and II colorectal cancer, the 5-year survival rate of surgical operation reaches 90% respectively. And 75%, and less than 10% for advanced patients. Moreover, the average survival time of advanced colorectal cancer after chemotherapy combined with molecular targeted therapy is still less than 30 months. Therefore, early screening and diagnosis of colorectal cancer is of great significance to improve the c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/154
Inventor 王弢秦勇刘广强邱黎清
Owner JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD