Mycobacterium tuberculosis Rv 3248 c recombinant protein, preparation method and application of mycobacterium tuberculosis Rv 3248 c recombinant protein

A technology of Mycobacterium tuberculosis and rv3248c, which is applied in the fields of botanical equipment and methods, biochemical equipment and methods, and applications, can solve problems such as low diagnostic value, and achieve high stability, high sensitivity, and reduced production costs. Effect

Inactive Publication Date: 2015-12-09
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, PPD has cross-reactions with environmental mycobacteria and BCG vaccine strains, so the diagnostic value is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis Rv 3248 c recombinant protein, preparation method and application of mycobacterium tuberculosis Rv 3248 c recombinant protein
  • Mycobacterium tuberculosis Rv 3248 c recombinant protein, preparation method and application of mycobacterium tuberculosis Rv 3248 c recombinant protein
  • Mycobacterium tuberculosis Rv 3248 c recombinant protein, preparation method and application of mycobacterium tuberculosis Rv 3248 c recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Construction of embodiment 1 recombinant plasmid pET28a-Rv3248c

[0037] (1) Target gene primer design

[0038] Rv3248c-F (SEQ ID No: 3):

[0039] GGAATT CCATAT GACCGGAAATTTGGTGACCAAAAATTCAAACAGCGCGCRv3248c-R (SEQ ID No: 4):

[0040] CCC AAGCTT GGTCAGTAGCGGTAGTGGTCCGCGTGCGGTCGAGCCAC

[0041] The enzyme cutting sites are NdeI and HindIII respectively.

[0042] (2) PCR amplification, cloning and sequence determination of the target gene

[0043] Mycobacterium tuberculosis H 37Rv genomic DNA was used as a template, Rv3248c-F and Rv3248c-R were used as primers, and the Rv3248c protein gene was directly amplified by PCR using Taq enzyme (Bao Biological Engineering (Dalian) Co., Ltd.). PCR reaction conditions: pre-denaturation at 94°C for 5 minutes; (94°C, 30s; 58°C, 30s; 72°C, 40s) 35 cycles; extension at 72°C for 5 minutes; storage at 4°C. After the reaction, the target fragment was separated by 1% agarose gel electrophoresis, and then recovered with a DNA recover...

Embodiment 2

[0044] Example 2 Induced expression and purification of recombinant protein Rv3248c

[0045] The eppdorf tube containing 100 μl of BL21(DE3) physS competent cells (TIANGEN) was immediately placed on ice from the -80°C freezer. After 3-5 minutes, wait for the liquid in the tube to melt, put 0.5 μl of the recombinant pET28a-Rv3248c plasmid with correct sequencing into the competent cells, place it on ice for 45 minutes, put it in a water bath at 42°C, heat shock for 90 seconds, and let it stand on ice for 3 minutes. Add 500 μl of preheated LB medium without antibiotics, shake at 37°C, 220rmp, and incubate for 45-60min. Take a certain amount and spread it on a solid LB medium plate containing kanamycin, dry it at room temperature and place it upside down in a 37°C incubator for overnight cultivation. Pick the clones, put them into LB liquid medium containing 50μg / ml kanamycin resistance, culture at 220rmp, 37°C to OD to about 0.6, add the final concentration of 10mMIPTG, 37°C fo...

Embodiment 3

[0047] Example 3 Recombinant Rv3248c antigen is used as a detection reagent to detect clinically suspected tuberculosis patients.

[0048] In this example, the recombinant protein Rv3248c antigen is used as a detection reagent to detect clinically suspected tuberculosis patients, and healthy people are used as a control group. At the same time, the commonly used tuberculosis diagnostic antigens ESAT-6 and CFP-10 are used for synchronous grouping experiments, and ELISPOT tests for specific antigens The design is shown in Table 1, and the operation steps are as follows:

[0049] 1. Sample collection: Aseptically collect about 5ml of human peripheral venous blood into a heparin anticoagulant tube. After collection, the sample can be stored at room temperature, and should not be placed in a refrigerator or freezer; and marked;

[0050] 2. Separation, collection and counting of peripheral blood mononuclear lymphocytes:

[0051] a. Take 5ml of whole blood, add an equal volume of RT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mycobacterium tuberculosis Rv 3248 c recombinant protein, a preparation method and application of the mycobacterium tuberculosis Rv 3248 c recombinant protein. The recombinant protein disclosed by the invention has an amino acid sequence shown as SEQ ID NO. 1. The invention also provides the preparation method of a coded nucleotide sequence of the mycobacterium tuberculosis Rv 3248 c recombinant protein and the recombinant protein. Based on a research result of immunomics, a mycobacterium tuberculosis immunodominant antigen Rv 3248 c is reported for the first time. By applying the mycobacterium tuberculosis Rv 3248 c recombinant protein to a tuberculosis cellular immunology diagnosis, higher sensitivity is achieved, besides the recombinant protein has the advantages of higher speed, safety and reliability in comparison with a conventional skin test.

Description

technical field [0001] The invention belongs to the technical field of biomedical in vitro diagnostic reagents, and in particular relates to a novel tuberculosis immune marker Rv3248c recombinant protein, its preparation method and its application. Background technique [0002] Tuberculosis is caused by the pathogen Mycobacterium tuberculosis infecting the body, and it is still an important infectious disease for humans. Rapid and accurate diagnosis of Mycobacterium tuberculosis (MTB) infection is of great significance for the control of tuberculosis. There are many diagnostic methods for MTB infection, and the most commonly used clinical method still relies on traditional sputum smear bacteriological examination, but the detection rate is low; MTB culture can be used as the "gold standard" for the diagnosis of tuberculosis, but the culture time is too long , generally 4-6 weeks, it is difficult to meet the clinical needs; Bactec technology shortens the culture time, but th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/35C12N15/31C12N15/70G01N33/68G01N33/569
CPCC07K14/35G01N33/5695G01N33/68
Inventor李荣秀张舒林马国荣张康周福强宋言峥
OwnerSHANGHAI JIAO TONG UNIV