Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology

A technology of zebrafish and hepcidin, applied in the field of molecular biology, can solve the problem of non-specificity of Cas protein

Inactive Publication Date: 2016-01-27
徐又佳
View PDF3 Cites 57 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] 1. Only one sgRNA needs to be synthesized to achieve specific modification of the gene, and the Cas protein is not specific.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology
  • Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology
  • Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0039] In order to solve the above-mentioned technical problems, the technical solution provided by the invention comprises the following steps:

[0040] (1) Design a gRNA sequence between the first exon and intron of the hepcidin gene, the gRNA sequence is CCAAGCGCCAAGTCACCTTTCC, as shown in SeqNo.1;

[0041](2) Design and synthesize gRNA primers, the primer sequence is P3:Forwardsequence(5'to3'):TAACGTGTTTCTGGCTGCTG, as shown in SeqNo.2,

[0042] P4: Reversesequence (5'to3'): AAAAGCACCGACTCGGTGCC, as shown in SeqNo.3;

[0043] (3) Perform a PCR reaction using the above-designed primers and gRNA-plasmid as a template. The PCR reaction system is as follows:

[0044]

[0045] The PCR reaction conditions are: pre-denaturation at 95°C for 3 minutes, entering a three-step cycle (95°C-20s, 58°C-20s, 72°C-20s, a total of 30 cycles), then 72°C-10min, and finally kept at 16°C; electrophoresis detection After the PCR product is purified;

[0046] (4) Under RNA-Free conditions, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention mainly relates to formation of zebrafish with hepcidin gene knocked out, by the use of CRISPR / Cas9 technology, a unique PAM region is designed, so that the hepcidin gene in the zebrafish is knocked out, and other genes are not accidentally injured. The first case of hepcidin knockout transgenic animal model zebrafish has great significance, the hepcidin is a major factor in the regulation of iron, once the hepcidin is knocked out, an animal model can be successfully molded into an iron overload animal model, the human factor intervention can be excluded, the hepcidin has great significance to iron expression researches, meanwhile compared with the traditional gene knockout technology, the CRISPR / Cas9 technology has low toxicity, high accuracy, high efficiency, short success cycle and other characteristics, and the hepcidin gene can be faster knocked out.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to the technology of knocking out the hepcidin gene in zebrafish by CRISPR / Cas9 technology. Background technique [0002] CRISPR / Cas9 is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight against invading viruses and foreign DNA. The CRISPR / Cas9 system provides immunity by integrating fragments of invading phage and plasmid DNA into CRISPR and utilizing corresponding CRISPR RNAs (crRNAs) to direct the degradation of homologous sequences. The working principle of this system is that crRNA (CRISPR-derived RNA) combines with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA / crRNA complex, which guides the nuclease Cas9 protein to cut at the sequence target site paired with crRNA double-stranded DNA. By artificially designing these two kinds of RNA, sgRNA (shortguideRNA) with guiding fu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89C12N15/11C12N15/10A01K67/027
Inventor 姜宇仲兆民朱国兴牛鹏飞杨健易利华陈斌徐又佳
Owner 徐又佳
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap