Preparation method of zebrafish with hepcidin gene knocked out by use of CRISPR / Cas9 technology
A technology of zebrafish and hepcidin, applied in the field of molecular biology, can solve the problem of non-specificity of Cas protein
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment 1
[0039] In order to solve the above-mentioned technical problems, the technical solution provided by the invention comprises the following steps:
[0040] (1) Design a gRNA sequence between the first exon and intron of the hepcidin gene, the gRNA sequence is CCAAGCGCCAAGTCACCTTTCC, as shown in SeqNo.1;
[0041](2) Design and synthesize gRNA primers, the primer sequence is P3:Forwardsequence(5'to3'):TAACGTGTTTCTGGCTGCTG, as shown in SeqNo.2,
[0042] P4: Reversesequence (5'to3'): AAAAGCACCGACTCGGTGCC, as shown in SeqNo.3;
[0043] (3) Perform a PCR reaction using the above-designed primers and gRNA-plasmid as a template. The PCR reaction system is as follows:
[0044]
[0045] The PCR reaction conditions are: pre-denaturation at 95°C for 3 minutes, entering a three-step cycle (95°C-20s, 58°C-20s, 72°C-20s, a total of 30 cycles), then 72°C-10min, and finally kept at 16°C; electrophoresis detection After the PCR product is purified;
[0046] (4) Under RNA-Free conditions, th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
