Application of promoting expression of I-type interferon by inhibiting activity of casein kinase 2
A casein kinase and interferon technology, applied in the field of immunology therapy, can solve the problems of ineffective expression of type I interferon and insufficient immune response, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0127] Example 1 Protein kinase CK2 is involved in regulating the expression of type I interferon induced by various pattern recognition receptors
[0128] Methods: Lenti-viral vector pLKO.1 was used to construct recombinant viral vectors expressing control shRNA or shRNA against CK2α, and then they were transfected into macrophage cell line (Raw264.7) and fibroblast cell line (L929), respectively, to establish A stable cell line with low expression of CK2α.
[0129] Firstly, the shRNA oligonucleotide sequence targeting CK2α was designed according to the CK2 gene sequence in NCBI genebank:
[0130] Forward(SEQ ID NO.:1):
[0131] CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTTG,
[0132] Reverse(SEQ ID NO.:2):
[0133] AATTCAAAAAACCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGG
[0134] The commercialized pLKO.1-TRCCloningVector vector (Addgene plasmid product number 10878) of Addgene Company and its standard operating procedures were used to construct the plasmi...
Embodiment 2
[0144] Example 2 Protein kinase CK2 is involved in regulating the expression of type I interferon induced by various viral infections
[0145] Methods: The control and CK2α knockdown stably transfected cell lines were divided into 10 6 cells / ml were inoculated into 6-well plates, 2ml per well. Infect DNA virus HSV-1 (1×10 7 pfu / ml), RNA virus vesicular virus VSV (2.5×10 5 TCID 50 / ml) and Sendai virus SeV (1×10 8 HA / ml). Six hours after virus infection, the cells were collected for RNA extraction and preparation. After 6 hours of infection with HSV virus, the medium was changed, and the culture was continued for 66 hours to collect the cell supernatant for the determination of HSV virus titer. Utilize TRIZOL (Invitrogen) method to extract the RNA of Raw264.7 and L929, and use SuperScript TM IIIReverseTranscriptase Kit (Invitrogen) was used to reverse transcribe 1 μg RNA to synthesize first-strand cDNA, which was used to detect gene expression level by real-time quantita...
Embodiment 3
[0147] Example 3 The kinase activity of CK2 plays a key role in regulating the expression of type I interferon
[0148] Methods: The cDNA encoding mouse CK2α wild-type and kinase-inactive mutant (K68M) were respectively cloned on the lenti-viral vector pCDH, and then they were transfected into L929 cell line, and the control cell lines were obtained by puromycin screening, expressing wild-type Type and mutant CK2α cell lines. The expression of wild-type and mutant CK2α was verified by Western blot ( Figure 7 A).
[0149] The cell lines expressing wild-type and mutant CK2α were divided into 10 6 cells / ml were inoculated into 6-well plates, 2ml per well. VSV (2.5×10 5 TCID 50 / ml) 6 hours after infection, the RNA in the prepared cells was extracted by TRIZOL (Invitrogen) method. Use SuperScript TM IIIReverse Transcriptase Kit (Invitrogen) was used to reverse transcribe 1 μg RNA to synthesize the first-strand cDNA, which was used to detect the expression level of type I i...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com