Application of promoting expression of I-type interferon by inhibiting activity of casein kinase 2

A casein kinase and interferon technology, applied in the field of immunology therapy, can solve the problems of ineffective expression of type I interferon and insufficient immune response, etc.

Inactive Publication Date: 2016-04-06
INST PASTEUR OF SHANGHAI CHINESE ACADEMY OF SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These regulatory mechanisms often lead to the ineffective expression of type I interferon in pathological conditions, resulting in various related diseases with insufficient immune response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of promoting expression of I-type interferon by inhibiting activity of casein kinase 2
  • Application of promoting expression of I-type interferon by inhibiting activity of casein kinase 2
  • Application of promoting expression of I-type interferon by inhibiting activity of casein kinase 2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] Example 1 Protein kinase CK2 is involved in regulating the expression of type I interferon induced by various pattern recognition receptors

[0128] Methods: Lenti-viral vector pLKO.1 was used to construct recombinant viral vectors expressing control shRNA or shRNA against CK2α, and then they were transfected into macrophage cell line (Raw264.7) and fibroblast cell line (L929), respectively, to establish A stable cell line with low expression of CK2α.

[0129] Firstly, the shRNA oligonucleotide sequence targeting CK2α was designed according to the CK2 gene sequence in NCBI genebank:

[0130] Forward(SEQ ID NO.:1):

[0131] CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTTG,

[0132] Reverse(SEQ ID NO.:2):

[0133] AATTCAAAAAACCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGG

[0134] The commercialized pLKO.1-TRCCloningVector vector (Addgene plasmid product number 10878) of Addgene Company and its standard operating procedures were used to construct the plasmi...

Embodiment 2

[0144] Example 2 Protein kinase CK2 is involved in regulating the expression of type I interferon induced by various viral infections

[0145] Methods: The control and CK2α knockdown stably transfected cell lines were divided into 10 6 cells / ml were inoculated into 6-well plates, 2ml per well. Infect DNA virus HSV-1 (1×10 7 pfu / ml), RNA virus vesicular virus VSV (2.5×10 5 TCID 50 / ml) and Sendai virus SeV (1×10 8 HA / ml). Six hours after virus infection, the cells were collected for RNA extraction and preparation. After 6 hours of infection with HSV virus, the medium was changed, and the culture was continued for 66 hours to collect the cell supernatant for the determination of HSV virus titer. Utilize TRIZOL (Invitrogen) method to extract the RNA of Raw264.7 and L929, and use SuperScript TM IIIReverseTranscriptase Kit (Invitrogen) was used to reverse transcribe 1 μg RNA to synthesize first-strand cDNA, which was used to detect gene expression level by real-time quantita...

Embodiment 3

[0147] Example 3 The kinase activity of CK2 plays a key role in regulating the expression of type I interferon

[0148] Methods: The cDNA encoding mouse CK2α wild-type and kinase-inactive mutant (K68M) were respectively cloned on the lenti-viral vector pCDH, and then they were transfected into L929 cell line, and the control cell lines were obtained by puromycin screening, expressing wild-type Type and mutant CK2α cell lines. The expression of wild-type and mutant CK2α was verified by Western blot ( Figure 7 A).

[0149] The cell lines expressing wild-type and mutant CK2α were divided into 10 6 cells / ml were inoculated into 6-well plates, 2ml per well. VSV (2.5×10 5 TCID 50 / ml) 6 hours after infection, the RNA in the prepared cells was extracted by TRIZOL (Invitrogen) method. Use SuperScript TM IIIReverse Transcriptase Kit (Invitrogen) was used to reverse transcribe 1 μg RNA to synthesize the first-strand cDNA, which was used to detect the expression level of type I i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an application of promoting the expression of an I-type interferon by inhibiting the activity of casein kinase 2. Specifically, the invention relates to the applications of casein kinase 2 (CK2) inhibitor: (i) in preparing medicinal compositions for promoting the expression of the I-type interferon (I-IFN) and/or the expression of I-IFN-induced genes or proteins thereof; and/or (ii) in preparing medicinal compositions for treating relevant diseases due to lack of I-IFN. The experiment proves that the inhibition on the CK2 can effectively induce and promote the generation of the I-IFN, and activate the expression of the downstream genes of the I-IFN, thus achieving good treatment effects for the relevant diseases due to lack of the I-IFN.

Description

technical field [0001] The present invention relates to the field of immunological therapy. Specifically, the present invention relates to a new application of casein kinase 2 inhibitors in promoting the expression of type I interferon and its downstream genes. Background technique [0002] Type I interferons include IFNα and IFNβ, which activate protein kinases Jak1 and Tyk2 after binding to interferon receptors on the cell surface, and then activate transcription factors STAT1 and / or STAT2 to induce the expression of hundreds of genes (interferon-induced Genes, ISGs), including MX1, MX2, Rsad2 / Viperine, CXCL10 / IP-10, etc. [0003] These genes induced by interferon play an important physiological role in the process of cell proliferation and apoptosis, angiogenesis, T cell immune response and so on. Therefore, the application of type I interferons in immune-related diseases has been extensively studied. [0004] The expression of type I interferon is induced by pattern r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/00A61K48/00A61K31/7088A61K39/395A61P31/12A61P35/00A61P25/28A61P37/02G01N33/68C07K14/56A61K31/4192A61K31/4184A61K31/352A61K31/192A61K31/519A61K31/366A61K31/122
CPCA61K39/395A61K45/00A61K48/00C12P21/02G01N33/68
Inventor 肖晖杜旻刘晶华谢亚栋钟劲向禹
Owner INST PASTEUR OF SHANGHAI CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap