Small interfering RNA for specific inhibition of MAGEA1 gene expression and application thereof
A small interference and genetic technology, applied in the field of genetic engineering, to achieve huge social benefits and economic value, the effect of inhibiting migration and invasion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Design, synthesis and transfection of siRNA specifically targeting the MAGEA1 gene into melanoma cells
[0031] 1. Design of siRNA specifically targeting MAGEA1 gene
[0032] In the public siRNA design website (URL: http: / / sirna.wi.mit.edu / home.php; https: / / www.thermofisher.com / cn / zh / home.html; http: / / sidirect2. rnai.jp / etc.) to input the mRNA sequence of MAGEA1, and follow the website instructions to predict the siRNA sequence that can knock down the expression of MAGEA1 mRNA.
[0033] Comparing the prediction results given by multiple websites, select siRNAs that are predicted on at least two websites at the same time.
[0034] Screen for siRNA sequences that have not been reported in the literature. The GC content of the siRNA sequence screened in this embodiment is 42.11%, and the lengths of the sense strand and the antisense strand are both 19 nt.
[0035] Specifically, its sense strand and antisense strand sequences are:
[0036] Sense strand: 5'GAGU...
Embodiment 2
[0046] Identify the mRNA expression level of MAGEA1 gene after embodiment 2 siRNA transfection
[0047] 1. Real-time quantitative PCR (q-PCR) identifies the mRNA expression level of the MAGEA1 gene of the melanoma cell A375 transfected with siRNA of the present invention in Example 1
[0048] Table 1q-PCR reaction system
[0049]
[0050] Front primer: AAGGTGGCTGATTTGGTTGGT
[0051] Back primer: CTGCAAGGACTCAGAGGCTTT
[0052] q-PCR reaction program: 95°C for 5min; 95°C for 15sec, 62°C for 30sec, cycle 35 times.
[0053] Use the real-time quantitative self-contained software to analyze the level of MAGEA1 gene expression, the results are shown in figure 1 . figure 1 It was shown that after the A375 cells were transfected with MAGEA1-specific siRNA, the expression level of MAGEA1 was only equivalent to 8.7% of the transfected negative control sequence (NC). 1: A375 cells not transfected with siRNA; 2: A375 cells transfected with negative control sequence; 3: A375 cells t...
Embodiment 3
[0055] Example 3 Identification of MAGEA1 protein expression level after siRNA transfection
[0056] 1. Identify the protein expression level of MAGEA1 gene by Western blot
[0057] Sample preparation: Adherent melanoma cells A375: washed twice with 1×PBS, digested with 100 μl trypsin, terminated with 500 μl culture medium and put into a 1.5ml EP tube. Centrifuge at 14,000 rpm for 5 minutes. Discard the supernatant and wash once with 200 μl 1×PBS. Add 50 μl of cell lysis buffer, shake vigorously to fully lyse the cells, and store at -20°C. Total protein was detected by BCA method. 5X Loading Buffer was diluted to 1X and added to the lysed cell samples. Heat denaturation at 95°C for 5 minutes, followed by centrifugation at 11500 rpm for 5 minutes.
[0058] 2. Configure 12% SDS-PAGE glue.
[0059] 3. Protein electrophoresis: sample spotting, at least 20 μg for each sample, and 3 μl for protein molecular weight markers. Constant voltage 100V, 30 minutes, then adjust the vo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More