A method for detecting microRNAs based on rolling circle amplification and upconversion materials
A technology for converting materials and detecting probes, applied in the fields of molecular biology and nucleic acid chemistry, can solve the problem of high background of DNA dyes, and achieve the effects of overcoming light scattering, high sensitivity, and good sequence selectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] 1. Design of microRNAs detection system
[0029] (1) if figure 1 As shown, the microRNAs detection probes used in the examples were synthesized by Shanghai Sangong Co., Ltd., and the probes were synthesized against the microRNAs let-7a sequence. The sequence of the microRNAs is: UGAGGUAGUAGGUUGUAUAGUU; the 3' end segment of the microRNA detection probe There are 11 bases that are complementary paired with the 5' end of the target microRNA, 11 bases are complementary paired with the 3' end of the target microRNA in the 5' end segment, and the middle segment is single-stranded DNA. The probe sequence from 5' end to 3' end is: phospho-CTACTACCTCATTTGCATTTCAGTTTACGGTTTAGCATTTCGCAATTTTAACTATACAAC. The added primer is a DNA sequence modified with biotin at the 5' end, which is exactly the same as a sequence in the probe. The primer sequence is: biotin-CAACCTACTACCTCATTTGC. In addition, the DNA modified on the upconversion material is characterized by the DNA sequence modifi...
PUM
Property | Measurement | Unit |
---|---|---|
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap