High-efficiency knockout method for XBP1 gene in DC cell

A gene knockout, cell technology, applied in the biological field, can solve the problem of reduced anti-tumor immune activity of DC cells, and achieve the effect of exerting anti-tumor immunity and ensuring immune stimulation.

Inactive Publication Date: 2016-05-25
SHENZHEN MORECELL BIOMEDICAL TECH DEV CO LTD
View PDF0 Cites 36 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the above-mentioned deficiencies in the prior art, and provide a method for knocking out the XBP1 gene in DC cells, aiming at solving the problem of the reduction of the anti-tumor immune activity of DC cells due to the existence and activation of the XBP1 gene in DC cells Adverse phenomenon

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency knockout method for XBP1 gene in DC cell
  • High-efficiency knockout method for XBP1 gene in DC cell
  • High-efficiency knockout method for XBP1 gene in DC cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1 of the present invention provides a DC cell XBP1 gene knockout method, comprising the following steps:

[0053] S11. Gene knockout target and oligonucleotide design

[0054] Taking the endoplasmic reticulum stress sensing factor XBP1 as the target gene, the CRISPR target sequence design and off-target site prediction were carried out for the XBP1 gene through online software (http: / / crispr.mit.edu). The target sequence finally selected after comprehensive analysis is underlined.

[0055] "...CGGTGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAG CCGCGCCGAACCCGGCCGA CGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGGAGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGC..." (SEQ ID NO: 1)

[0056] The designed insert oligonucleotide sequence is as follows:

[0057] The forward oligonucleotide sequence is:

[0058] 5'GAAACACCG CCGCGCCGAACCCGGCCGA GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT3’

[0059] The reverse oligonucleotide sequence is:

[0060] 5'AACGGACTAGCC...

Embodiment 2

[0104] Embodiment 2 of the present invention provides a method for knocking out XBP1 gene in DC cells. The method comprises the steps of:

[0105] S21. Gene knockout target and oligonucleotide design

[0106] Directly follow S11 in Example 1 for processing.

[0107] S22. Ligation and identification of pCas9 / gRNA1 gene knockout vector

[0108] Directly follow step S12 in Embodiment 1 for processing.

[0109] S23. DC cell culture

[0110] Process directly according to step S13 in Embodiment 1.

[0111] Knockout of XBP1 gene in S24.DC cells

[0112] The grouping of S241DC is as follows:

[0113] (1) negative control group; (NC-DC)

[0114] (3) pCas9 / gRNA1-XBP1+L189 group. (XBP1 / L189-DC)

[0115] S242XBP1 gene knockout

[0116] (1) On the sixth day of DC culture, plasmid dilutions were prepared according to the system in Table 4 below. Wherein, the pCas9 / gRNA1-XBP1 shown in Group 3 in Table 4 is the pCas9 / gRNA1-XBP1 plasmid prepared in Step S22 of Example 2.

[0117] T...

Embodiment 3

[0138] DC stimulated T cell anti-tumor experiment

[0139] S31DC-T cell culture

[0140] (1) Use the Alys-505 culture solution containing 0.5% autologous plasma to adjust the cell density to 1×106 / ml for the non-adherent cells before culturing DC cells in step S13 in Example 1, and transfer them to a six-well plate, 2ml / well, while adding 1000U / ml of IFN-γ to each well, placed in saturated humidity, 37°C, 5.0% CO 2 cultured in an incubator.

[0141] (2) After 24 hours, add 50ng / ml CD3 monoclonal antibody, 1000U / ml IL-2, 1000U / ml IL-1α to each well, and place in saturated humidity, 37°C, 5.0% CO 2 Continue to grow in the incubator.

[0142] (3) Adjust the cell density to 1×106 / ml every 3 days, and add Alys-505 culture solution containing 1000U / ml IL-2 and 0.5% autologous plasma.

[0143] (4) On the 9th day, three kinds of DC cells (NC-DC, XBP1-DC (transfected DC in Example 2), XBP1 / L189-DC (transfected DC in Example 3)) were mixed with T cells at 1 :10, and continued to c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high-efficiency knockout method for the XBP1 gene in a DC cell. The high-efficiency knockout method for the XBP1 gene in the DC cell comprises the following steps: designing of a gene knockout target and oligonucleotide; annealing of oligonucleotide; enzyme digestion of a linearized vector; connection and reaction of the linearized vector with double-strand oligonucleotide; transformation of competent cells and knockout of the XBP1 gene in the DC cell; etc. According to the invention, the knockout method provided by the invention employs an improved CRISPR / pCas9 gene knockout system, uses the XBP1 as a target gene for designing of a CRISPR targeting sequence and preparation of pCas9 / gRNA1-XBP1 plasmid and further allows the plasmid to transfect the DC cell under the treatment action of an L189 drug; thus, the XBP1 gene in the DC cell can be effectively knocked out, the immunostimulation effect of the DC cells can be effectively guaranteed, and antineoplastic immunization effect of the DC cell is given to effective play.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an efficient DC cell XBP1 gene knockout method. Background technique [0002] Dendritic cells (Dendritic Cells, DCs) are crucial for stimulating and maintaining T cell-dependent anti-tumor immune responses. However, tumors can evade the killing effect of the immune system by weakening the function of DC cells. Studies have shown that the activation of the endoplasmic reticulum stress-sensing factor XBP1 in DC cells leads to a decrease in the anti-tumor immune activity of DC cells, which eventually leads to tumor progression. XBP1 can regulate lipid metabolism in DC cells, and the by-products of lipid peroxidation can stimulate the biosynthesis reaction of triacylglycerol in DC cells, resulting in abnormal lipid accumulation, which ultimately inhibits the function of DC and cannot effectively stimulate antitumor activity. active T cells. Therefore, if the expression of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N5/0784
Inventor不公告发明人
OwnerSHENZHEN MORECELL BIOMEDICAL TECH DEV CO LTD