Unlock instant, AI-driven research and patent intelligence for your innovation.

Chicken leukemia endogenous virus ev21 molecular marker and its primers, identification method and application

An ev21, molecular identification technology, applied in the field of molecular genetics, can solve the problems of difficult amplification, time-consuming, reporting errors, etc., and achieve the effect of good specificity and high amplification efficiency

Inactive Publication Date: 2019-04-19
HEBEI AGRICULTURAL UNIV. +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the high cost and time-consuming of Southern-blot technology, site-specific PCR technology is now generally used to identify
Previous studies have also obtained 390bp or 515bp sequences by PCR to identify the existence of ev21, but because the full length of the ev21 gene sequence is 7524bp, it is very difficult to amplify, so only relatively small sequencing sequences have been successfully amplified, and no relatively complete sequence has been obtained. The report of the viral genome sequence has brought many obstacles to the research of ev21
In addition, because the previous amplifications only amplified a small part of ev21, and ev21 has a repetitive sequence, and its insertion region and LTR have polymorphisms, so reports about its gene sequence being linked to the slow-feather chicken K gene there may be errors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chicken leukemia endogenous virus ev21 molecular marker and its primers, identification method and application
  • Chicken leukemia endogenous virus ev21 molecular marker and its primers, identification method and application
  • Chicken leukemia endogenous virus ev21 molecular marker and its primers, identification method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] A molecular identification method for chicken leukemia endogenous virus EV21, comprising the following steps:

[0051] 1), the extraction of template DNA;

[0052] 2), with primers shown in SEQ ID NO:2 and SEQ ID NO:3, carry out PCR amplification with the DNA extracted in 1) as template;

[0053] 3), the amplified product SEQ ID NO:1 obtained by PCR amplification in 2) is subjected to electrophoresis analysis.

Embodiment 2

[0055] A molecular identification method for chicken leukemia endogenous virus EV21, comprising the following steps:

[0056] 1) Extraction of template DNA: usually extracted from chicken blood, of course, can also be extracted from other tissues.

[0057] 2), with primers shown in SEQ ID NO:2 and SEQ ID NO:3, carry out PCR amplification with the DNA extracted in 1) as template;

[0058] The reaction system for PCR amplification is:

[0059]

[0060] Wherein, the concentration of forward primer and reverse primer is 12 μ M;

[0061] The concentration of DNA template in the PCR reaction system is 150ng / μl;

[0062] The reaction procedure is:

[0063]

[0064] 3) Perform 1% agarose gel electrophoresis electrophoresis analysis on the amplification product SEQ ID NO: 1 obtained by PCR amplification in 2), the electrophoresis voltage is 130V constant voltage, and the electrophoresis time is 20 minutes.

Embodiment 3

[0066] A molecular identification method for chicken leukemia endogenous virus EV21, comprising the following steps:

[0067] 1) Extraction of template DNA: usually extracted from chicken blood, of course, can also be extracted from other tissues.

[0068] 2), with primers shown in SEQ ID NO:2 and SEQ ID NO:3, carry out PCR amplification with the DNA extracted in 1) as template;

[0069] The reaction system for PCR amplification is:

[0070]

[0071] Wherein, the concentration of forward primer and reverse primer is 8 μ M;

[0072] The concentration of DNA template in the PCR reaction system is 50ng / μl;

[0073] The reaction procedure is:

[0074]

[0075] 3) Perform 1% agarose gel electrophoresis electrophoresis analysis on the amplified product SEQ ID NO: 1 obtained by PCR amplification in 2), the electrophoresis voltage is 140V constant voltage, and the electrophoresis time is 23 minutes.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular genetics and in particular relates to an avian leucosis endogenous virus ev21 molecular marker and a primer thereof. A forward primer of the primer is: 5'GGAGGGAGACTATTTTTACACG3', and a reverse primer of the primer is: 5'GTTTAACGGACCAACAGGCTAGTCTCTCG'. The primer has good specificity and high amplification efficiency, and an amplification product contains an ev21 gene sequence with 6614bp. The invention also provides a molecular identification method on an avian leucosis endogenous virus ev21. The molecular identification method and the primer are matched for carrying out experiment, operation is simple, feasibility is high, and the molecular identification method also can be applied to molecular purification on fast or slow feathering type avian endogenous leucosis virus ev21 or fast or slow feathering phenotype identification on some breeds of chickens.

Description

technical field [0001] The invention relates to the field of molecular genetics, in particular to a molecular marker of chicken leukemia endogenous virus ev21 and its primers, identification method and application. Background technique [0002] Avian leukemia viruses (ALVs) are a class of retroviruses that cause neoplastic proliferation of various hematopoietic cells in birds. There are six subtypes (A, B, C, D, E, and J) of chicken-specific ALVs. Leukemia virus E (ALVE) is an endogenous virus (EV) in chickens. Its complete or partial genetic sequence elements are integrated into the chicken cell chromosome genome, and replicate with the chicken genome replication, following the Mendelian law of inheritance. It has the potential to affect the physiological function of chicken body. ev21 is a kind of ALVE, and its transcriptional activation affects the infection and disease occurrence of exogenous viruses, and affects important economic traits such as egg production, egg we...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/702C12Q2600/156
Inventor 李兰会张秀玲李祥龙张乐超刘春杨臧素敏周荣艳
Owner HEBEI AGRICULTURAL UNIV.