Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pseudofusicoccum sp. F10 for producing indigo blue pigment and printing and dyeing application thereof

A technology of Botrytis, indigo pigment, applied in the directions of fungi, dyeing, biochemical equipment and methods, etc.

Active Publication Date: 2016-06-22
LUOHE MEDICAL COLLEGE
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report about the indigo pigment-producing fungus Pseudofusicoccumsp.F10 and its application in printing and dyeing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudofusicoccum sp. F10 for producing indigo blue pigment and printing and dyeing application thereof
  • Pseudofusicoccum sp. F10 for producing indigo blue pigment and printing and dyeing application thereof
  • Pseudofusicoccum sp. F10 for producing indigo blue pigment and printing and dyeing application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: A strain of indigo pigment-producing Botrytis fungus Pseudofusicoccumsp.F10 (preservation unit: China Center for Type Culture Collection; preservation time: May 12, 2015; preservation address: Luojia Mountain, Wuchang, Wuhan (Wuhan University ), the zip code is 430072; the preservation number: CCTCCNO: M2015293, the classification belongs to the family Botrytisaceae, the genus Botrytis,

[0029] The indigo pigment-producing fungus of the genus Pseudofusicoccum sp.F10 (preservation number: CCTCCNO: M2015293) is characterized in that the coloring of the aerial hyphae of the fungus changes from off-white to black with the growth of the fungus. The color of the back of the plate (PSA, cultivated on potato sucrose agar) gradually turns blue-gray, and finally turns blue-black, and the top of the aerial hyphae forms a capitulum, producing transparent conidia, such as figure 1 shown.

[0030] The indigo pigment-producing fungus of the genus Pseudofusicoccumsp.F10 (p...

Embodiment 2

[0047] Example 2: A strain of indigo pigment-producing Botrytis fungus Pseudofusicoccumsp.F10 (preservation number: CCTCCNO: M2015293) has a bacterial fermentation liquid that is characteristic of printing and dyeing cotton fabrics: cotton fabrics are dyed in the bacterial fermentation liquid by the post-media method at 90°C Dye for 60 minutes, cool down to 70°C, add mordant NaCl (5g / L), raise the temperature to 90°C, keep the temperature for 30 minutes, take out the cloth sample after cooling down to room temperature, wash it with water and dry it; repeat dyeing for many times, the dyeing effect is good.

[0048]ACCTACCGGGATTAGGGTCTCTTCCCGAGCCCACTCTCCAACCCTTTGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTTCTCCGCGGCCGGCCCCCTAGCCGGGGCTGGCCTGCGCCCGCCAGAGGACCACAAAACTCCAGTCAGTGAACTTTGCTGTCTGATATAAATTCAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTCTGCTTGGTATTGGGCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of light chemical engineering and aims at providing Pseudofusicoccum sp. F10 and printing and dyeing application thereof. The Pseudofusicoccum sp. F10 can produce an indigo blue pigment, the pigment is a compound with C-CH3 substituents and containing para-aminobenzoic acid, the biggest absorption peak of the pigment in a neutral and weakly-alkaline water solution is located at the position of 620 nm, the pigment precipitates in an acidic water solution and is not sensitive to oxidants, and a reducing agent sodium sulfite has the damage effect on the pigment. During dyeing and printing application, the pigment has the good printing and dyeing effect on cotton fabrics, and a mordant NaCl is conducive to the dyeing effect. The novel natural dye obtained by adopting the Pseudofusicoccum sp. F10 is safe, is environmentally friendly and is not limited by regions or environments, the fungal pigment has good reproducibility, the yield is increased remarkably by adopting a biological cultivation method, and industrialization is easier to achieved.

Description

technical field [0001] The invention relates to the field of light chemical industry, in particular to an indigo pigment-producing fungus of the genus Pseudofusicoccum sp. F10 and its application in printing and dyeing. Background technique [0002] Pigment is a coloring agent, which is an important part of the printing and dyeing industry and food additives. It can improve the color of printed and dyed articles and food, and is one of the key factors determining product quality. The color of the product is the first sensory impression that the product gives to consumers, which directly affects the sales performance of the product. Therefore, it is very important for the product to have a safe tone and color. Pigments are generally divided into synthetic pigments and natural pigments. Although synthetic pigments occupy a dominant position in the market, with reports that synthetic pigments are toxic, carcinogenic, and may even cause damage to important organisms, the safety...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14C12P17/16D06P1/34C12R1/645
CPCC12P17/165C12N1/145C12R2001/645D06P3/60
Inventor 王飞赵丽芳罗海澜马翠云刘少阳魏永义
Owner LUOHE MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com