Pseudofusicoccum sp. F10 for producing indigo blue pigment and printing and dyeing application thereof
A technology of Botrytis, indigo pigment, applied in the directions of fungi, dyeing, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: A strain of indigo pigment-producing Botrytis fungus Pseudofusicoccumsp.F10 (preservation unit: China Center for Type Culture Collection; preservation time: May 12, 2015; preservation address: Luojia Mountain, Wuchang, Wuhan (Wuhan University ), the zip code is 430072; the preservation number: CCTCCNO: M2015293, the classification belongs to the family Botrytisaceae, the genus Botrytis,
[0029] The indigo pigment-producing fungus of the genus Pseudofusicoccum sp.F10 (preservation number: CCTCCNO: M2015293) is characterized in that the coloring of the aerial hyphae of the fungus changes from off-white to black with the growth of the fungus. The color of the back of the plate (PSA, cultivated on potato sucrose agar) gradually turns blue-gray, and finally turns blue-black, and the top of the aerial hyphae forms a capitulum, producing transparent conidia, such as figure 1 shown.
[0030] The indigo pigment-producing fungus of the genus Pseudofusicoccumsp.F10 (p...
Embodiment 2
[0047] Example 2: A strain of indigo pigment-producing Botrytis fungus Pseudofusicoccumsp.F10 (preservation number: CCTCCNO: M2015293) has a bacterial fermentation liquid that is characteristic of printing and dyeing cotton fabrics: cotton fabrics are dyed in the bacterial fermentation liquid by the post-media method at 90°C Dye for 60 minutes, cool down to 70°C, add mordant NaCl (5g / L), raise the temperature to 90°C, keep the temperature for 30 minutes, take out the cloth sample after cooling down to room temperature, wash it with water and dry it; repeat dyeing for many times, the dyeing effect is good.
[0048]ACCTACCGGGATTAGGGTCTCTTCCCGAGCCCACTCTCCAACCCTTTGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTTCTCCGCGGCCGGCCCCCTAGCCGGGGCTGGCCTGCGCCCGCCAGAGGACCACAAAACTCCAGTCAGTGAACTTTGCTGTCTGATATAAATTCAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTACACCCCTCAAGCTCTGCTTGGTATTGGGCG...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap