Sequencing library building method and reagent based on molecular inverse probe

A molecular reverse probe and sequencing library technology, applied in the field of molecular biology, can solve the problems of time-consuming single-stranded circular library construction, complex enrichment of target regions, and cost-consuming problems, achieving low initial volume and reducing errors , the effect of simple process

Active Publication Date: 2016-06-29
MGI TECH CO LTD
View PDF2 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is no application of MIP technology in the sequencing platform with single-stranded circular library as the sequencing object, to solve the problem of time-consuming, labor-intensive, cost-consuming and complex enrichment of target regions in the construction of single-stranded circular library

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequencing library building method and reagent based on molecular inverse probe
  • Sequencing library building method and reagent based on molecular inverse probe
  • Sequencing library building method and reagent based on molecular inverse probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] In this embodiment, the genomic DNA (gDNA) of Yanhuang (YH) is used as the experimental material, and a certain site of deafness gene detection is taken as an example.

[0075] The detection sites and nearby sequences are as follows, where underlined bold italics is the site to be detected; the underlined sequence is the sequence at both ends of the target region, which specifically binds to the anchor sequence and extension sequence of the molecular reverse probe.

[0076] 5'-AGGATCGTTGTCATCCAGTCtcttccttagga attcattgcctttggg atcagc acatcttctcaggattcttctcttgttttgtg gccaccactgctctttc ccgcacggccgtccaggagagcactggaggaaagacaCAGGTAGGAACAACAGCCTT-3' (SEQ ID NO: 6).

[0077] According to the above detection sites and nearby sequences, the following molecular reverse probe sequences were designed, in which the underlined sequences were the anchor sequence and extension sequence of the molecular reverse probe.

[0078] 5'-pho_CCCAAAGGCAATGAAT AGGTATCTCAGTTCGGTGTAGGTCGTT...

Embodiment 2

[0098] In this embodiment, human peripheral blood DNA (300ng) is used as the experimental material, and the probe regions are seven regions on the congenital deafness gene 12S-rRNA, GJB2, GJB3, and SLC26A4. The probe site information is shown in Table 3. The CompleteGenomics platform was used as the sequencing platform, and the SE50 sequencing type was adopted.

[0099] table 3

[0100]

[0101]

[0102] The experimental process is as follows:

[0103] 1. MIP hybridization

[0104] The enzyme reaction system is shown in Table 4, wherein the MIP probe is obtained by using the sequences of SEQ ID NO: 1-3 in the first method of the above-mentioned probe preparation.

[0105] Table 4

[0106] components

Dosage

Genomic DNA

5-300ng

MIP probe

1 fmol

Ampligase buffer

2μL

dNTP (10mM)

2μL

Ampligase

1μL

Phusion

0.5μL

water

Make up 20μL

[0107] Reaction program: 5 minutes at 95°C, 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sequencing library building method and reagent based on a molecular inverse probe. The method includes: using the molecular inverse probe and denatured nucleic acid to perform annealing hybridization, wherein the molecular inverse probe comprises the anchoring sequence of a 5' end, the extension sequence of a 3' end and the sequencing connector sequence between the anchoring sequence and the extension sequence, and the anchoring sequence and the extension sequence are respectively inversely complementary with sequences at two ends of a target area; using the target area as a template, and performing polymerization reaction starting from the extension sequence of the 3' end to generate the supplementary sequence of the target area; connecting the anchoring sequence of the 5' end with the supplementary sequence of the target area to form cyclic annular nucleic acid molecules; using exonuclease to digest non-cyclized linear molecules to obtain single-chain cyclic annular molecules containing the target area; sequencing the obtained single-chain cyclic annular molecules so as to achieve capture sequencing of the target area. The sequencing library building method has the advantages that the building of a single-chain cyclic annular library and target area capture are integrated, and library building process and cycle are shortened greatly.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a molecular reverse probe-based sequencing library construction method and reagents. Background technique [0002] With the development of DNA sequencing technology, high-throughput sequencing technology has been widely used in various fields of life science research. Although the cost of sequencing technology is getting lower and lower with the continuous updating and popularization of sequencing technology, the cost of whole genome sequencing technology itself is still very expensive. A better solution to reconcile this problem is to enrich the target region of interest for high-throughput sequencing. Traditional sequence capture technology usually constructs a high-throughput sequencing library, and then uses probes to enrich the library of the target region and then sequence. [0003] The sequencing platform represented by the CG (Complete Genomics) sequencing pla...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C40B50/06C12Q1/68
CPCC12Q1/6869C40B50/06C12Q2525/191C12Q2521/319
Inventor耿春雨于源李梅艳郭晶蒋慧章文蔚郭荣荣傅书锦田凯安丹贺玲瑜
OwnerMGI TECH CO LTD