A kind of multiple PCR primer and its application in turbot culture
A multiple and specific technology, applied in microorganism-based methods, microbial determination/inspection, microorganisms, etc., can solve the problems of economic loss of farmers, restrict the healthy development of turbot breeding industry, etc., and achieve simple detection and high sensitivity. , strong specific effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Embodiment 1 A kind of multiplex PCR primer
[0061] (1) Design of multiplex PCR primers
[0062] This embodiment aims at the dnaJ gene of strain Aeromonas hydrophila Aeromonas hydrophila, Aeromonas sobria Aeromonas sobria and Aeromonas schubertii Aeromonas schubertii, utilizes MEGA6 software, designs the anti-Aeromonas hydrophila Aeromonas Hydrophila, Aeromonas sobria Aeromonas sobria and Aeromonas schubertii Aeromonas schubertii have three pairs of specific primers with strong specificity and high sensitivity The specific information of the multiple specific primers is shown in Table 1.
[0063] Table 1
[0064]
[0065] (2) Exploration of optimal PCR reaction conditions for multiplex PCR primers
[0066] 1. DNA extraction of strains to be tested
[0067] The DNA of Aeromonas hydrophila (Aeromonas hydrophila), Aeromonas sobria (Aeromonas sobria) and Aeromonas schubertii (Aeromonas schubertii) were extracted using Ezup column's genomic DNA extraction kit (bacter...
Embodiment 2
[0095] Example 2 A multiplex PCR detection method for pathogenic bacteria in turbot breeding process
[0096] Model: A turbot model infected with Aeromonas hydrophila was made.
[0097] Methods as below:
[0098] 1. Extract the total DNA of bacteria in the lesion site of turbot;
[0099] The tissue at the lesion was washed repeatedly with 1ml sterile water, at least three times, then the liquid was collected, and the Ezup column's genomic DNA extraction kit (bacteria) was used to extract the total DNA of the bacteria at the lesion of turbot. The specific steps were as in the above example Step 1 of (2) in 1.
[0100] 2. Using the extracted DNA as a template, the multiple PCR primers described in Example 1 were used to amplify by PCR method to obtain
[0101] to the PCR product;
[0102] The sequence of the upstream primer F1 is: CGACGTGTTTGGCGATATTTTTG
[0103]The sequence of the downstream primer R1 is: GTCTTGGTCTTCTGGTAGCGA
[0104] The sequence of the upstream primer ...
Embodiment 3
[0115] Example 3 A multiplex PCR detection method for pathogenic bacteria in the process of turbot culture
[0116] Model: Making a turbot model infected with Aeromonas temperatus.
[0117] Method is with embodiment 2.
[0118] Results: For the detection of 26 turbots infected with Aeromonas temperii, the agarose gel only showed a 486bp band.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com