Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for determining enzyme activity of leucyl-tRNA synthetase

A technology of synthesizing enzymes and leucyl, applied in the biological field, can solve problems such as complicated operation steps and environmental pollution, and achieve the effect of overcoming environmental pollution and saving costs

Inactive Publication Date: 2016-07-13
SHENYANG PHARMA UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The operation steps of the above method are complicated, and the introduction of radioactive isotopes 14 C, it is very easy to cause pollution to the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for determining enzyme activity of leucyl-tRNA synthetase
  • Method for determining enzyme activity of leucyl-tRNA synthetase
  • Method for determining enzyme activity of leucyl-tRNA synthetase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] This embodiment is illustrated by taking the measurement of the activity of the leucyl-tRNA synthetase of Mycobacterium smegmatis (Mycobacterium smegmatis CGMCC1.2621) as an example.

[0024] The sequence of the gene leuRS encoding Mycobacterium smegmatis leucyl-tRNA synthetase is shown in SEQID.

[0025] 1. Construction of recombinant plasmid pET28a(+)-leuRS

[0026] Using the genomic DNA of Mycobacterium smegmatis as a template, the leuRS gene was amplified by PCR.

[0027] The primer sequences are as follows:

[0028] Upstream primer 5'>CCG GTGACCCAACCGGCAACCA<3';

[0029] Downstream primer 5'>CCC CTAGGCGACCAGCGTGACCCCCC>3'.

[0030] The parts in italics are the restriction sites of EcoRI and HindIII respectively.

[0031] The PCR reaction system includes:

[0032] Genomic DNA 2μl

[0033] Upstream primer (20pM) 1μl

[0034] Downstream primer (20pM)) 1 μl

[0035] buffer 5μl

[0036] Taq enzyme 1 μl

[0037] wxya 2 O40μl

[0038] Total volume 50μl

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for determining enzyme activity of leucyl-tRNA synthetase. According to the method for determining the enzyme activity of the leucyl-tRNA synthetase, the content of pyruvic acid in a product is determined with a standard curve production method, that is, the light absorbance value of pyruvic acid in the product at the wavelength of 290-340 nm is determined, the corresponding concentration of pyruvic acid is obtained from a standard curve, the content of pyruvic acid in the product is further obtained, and the enzyme activity of leucyl-tRNA synthetase is calculated according to the content of pyruvic acid. The operation steps are simpler than those of a reported radioactive ray labeling method for determining the enzyme activity of leucyl-tRNA synthetase, and pollution caused by usage of radioactive ray markers to the environment is avoided.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for measuring the enzyme activity of leucyl-tRNA synthetase and its application. Background technique [0002] Aminoacyl-tRNA synthetase (aaRS) is a class of enzymes that widely exist in various organisms such as animals, plants, bacteria and viruses, and can catalyze the connection of specific amino acids to corresponding tRNA molecules. play an important role in the synthesis process. Because aminoacyl-tRNA synthetase is an indispensable part of organisms, and there are large differences between prokaryotes and eukaryotes, the multi-drug resistance of bacteria is generally stronger and stronger, and the development of new drugs is becoming more and more difficult. Today, with more urgency, people are turning their attention to such potential drug targets. [0003] In recent years, great breakthroughs have been made in drug research targeting aminoacyl-tRNA synthetase, but ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/31
CPCG01N21/31
Inventor 徐威陈羽仉蕊宋鹏徐慰倬李然然
Owner SHENYANG PHARMA UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com