Supercharge Your Innovation With Domain-Expert AI Agents!

Method for detecting fluorogenic quantitative PCR of Zika virus, primers and kit

A fluorescent quantitative and Zika virus technology, applied in the field of primers and kits, fluorescent quantitative PCR method for detection of Zika virus, to achieve the effects of short detection time, wide application range, and simple operation

Inactive Publication Date: 2016-08-10
THE THIRD PEOPLES HOSPITAL OF SHENZHEN
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, there is no report on the detection of Zika virus by fluorescent quantitative PCR

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting fluorogenic quantitative PCR of Zika virus, primers and kit
  • Method for detecting fluorogenic quantitative PCR of Zika virus, primers and kit
  • Method for detecting fluorogenic quantitative PCR of Zika virus, primers and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] This embodiment provides a primer, probe and application for detecting Zika virus.

[0051] Design of primers and probes: By comparing the Zika virus E gene, looking for conserved regions, and designing specific primers and probes that can cover all strains.

[0052] The specific sequences of primers and probes are as follows:

[0053] Upstream primer (ZIKV-F): 5'-TGACAAGCARTCAGACAC-3' (SE Q ID NO.1) (R stands for A or G)

[0054] Downstream primer (ZIKV-R): 5'-TCACCAGRCTCCCTTTGC-3'(SEQ ID NO.2) (R stands for A or G)

[0055] Probe (ZIKV-P): 5'-HEX-AGAGGCTGGGGAAATGGATGTGGACT-TRAMA-3'(SEQ ID NO.3)

[0056] Both primers and probes were synthesized by Shanghai Sangon Bioengineering Co., Ltd., and the size of the amplified target fragment was 98bp. The target sequence was: tgacaagcaatcagacactcaatatgtctgcaaaagaacgttagtggacagaggctggggaaatggatgtggactttttggcaaagggagcctggtga (SEQ ID NO: 4).

[0057] The above primers and probes can be applied to the preparation of products f...

Embodiment 2

[0059] This embodiment provides a kit and application thereof, the kit comprising:

[0060] (1) primers and probes of embodiment 1;

[0061] (2) Fluorescent quantitative PCR amplification reagents.

[0062] Described fluorescent quantitative PCR reagent comprises the One StepPrimeScript that the article number from Takara company is RR064A TM Reagents included in the RT-PCR Kit.

[0063] Experiments have proved that the combined use of the above fluorescent quantitative PCR amplification reagents, primers and probes has a more superior effect, which is specifically manifested in the characteristics of good repeatability, strong specificity, and high sensitivity.

[0064] The test kit can further include:

[0065] (3) positive control and negative control;

[0066] (4) RNA extraction reagents;

[0067] (5) Reverse transcription reagents.

[0068] The positive control is a standard plasmid obtained by amplification and cloning. The amplification and cloning refer to the u...

Embodiment 3

[0072] This embodiment provides a method for detecting Zika virus, such as detecting the presence and / or content of Zika virus in a biological sample. The method uses the primers and probes in Example 1 and the kit in Example 2.

[0073] The above-mentioned biological samples are blood, cells or tissues containing DNA and / or RNA, or plasmids, or DNA, cDNA, mRNA or cDNA fragments, or reagents containing DNA, cDNA, mRNA or cDNA fragments.

[0074] When the biological sample is DNA, cDNA or cDNA fragments, or a reagent containing DNA, cDNA or cDNA fragments, or a plasmid, it is directly used as a template to perform real-time fluorescent PCR reaction with the primer and probe pair.

[0075] When the biological sample is blood, cells or tissues containing DNA and / or RNA, or mRNA, or a reagent containing mRNA, convert it into DNA, cDNA or cDNA fragments and then perform real-time fluorescence with the primers and probes PCR reaction.

[0076] The method for detecting Zika virus co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Copy numberaaaaaaaaaa
Login to View More

Abstract

Fluorescent quantitative PCR method, primers and kit for detecting Zika virus. The invention provides a set of primers and probes, wherein one primer comprises the nucleotide sequence shown in SEQ ID NO: 1, and the other primer comprises the nucleotide sequence shown in SEQ ID NO: 2, and the invention also provides The primers and probes are used in the preparation of products for detecting Zika virus, and the invention also provides kits and applications containing the primers and probes. Experiments have proved that the primers and probes of the present invention have good specificity, high sensitivity, short detection time and wide application range, and the detection method of Zika virus established based on the primers and probes can be sensitive, accurate, simple and fast The detection of the presence and / or amount of Zika virus.

Description

technical field [0001] The invention relates to the field of biological detection, in particular to a fluorescent quantitative PCR method, primers and a kit for detecting Zika virus. Background technique [0002] Zika virus disease is an acute self-limiting disease caused by Zika virus (ZIKV) and transmitted by mosquitoes. ZIKV was first discovered from rhesus monkeys in Uganda in 1947, and the virus was isolated from humans in Uganda and Tanzania in 1952. ZIKV mainly relies on virus-infected Aedes mosquitoes to transmit through bites, and can also be transmitted through mother-to-child transmission, blood and sexual transmission. Before 2007, only 14 sporadic cases of ZIKV disease were reported in the world. After the Zika virus outbreak was first discovered in Yap Island, Micronesia, a Pacific island country in 2007, the number of countries and regions with ZIKV infection cases and outbreaks increased significantly. , has caused multiple outbreaks in Africa, Southeast As...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/70C12Q1/68C12M1/00C12M1/34
CPCC12Q1/701C12Q1/6851
Inventor 刘映霞高福杨扬毕玉海王强郑海霞
Owner THE THIRD PEOPLES HOSPITAL OF SHENZHEN
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com