Reagent kit for detecting clear renal cell carcinoma
A technology of clear cell renal cell carcinoma and kit, which is applied in the field of detection kits for clear cell renal cell carcinoma, which can solve the problems of complex preparation, high requirements for antibody preparation, and detection limitations, and achieve the effect of simple preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Embodiment 1: the acquisition of albumen
[0059] According to the eukaryotic expression method in the prior art, the corresponding protein is obtained. For example, using a method similar to that in (Using Insect Baculovirus to Express DUSP1 and Its Effect on Tumor Cells), the protein was harvested, and a protein stock solution with a DUSP-9 protein concentration of 50 mg / mL was obtained by protein concentration technology.
Embodiment 2
[0060] Example 2 Nucleic Aptamer Screening
[0061] From a random oligomeric DNA library synthesized in vitro, (5'-TTGACAGGGAGCATTAGCAT-N35-GCATTACCATGAAGTTGCAC-3'), wherein N35 is 35 random oligonucleotides;
[0062] Primer P1: TTGACAGGGAGCATTAGCAT; Primer P2: GTGCAACTTCATGGTAATGC.
[0063] (1) 1 mg of DUSP-9 protein was dissolved in 200 μl of PBS, added to a 96-well ELISA plate, and left overnight at 4°C.
[0064] (2) After the protein-coated wells were washed 6 times with PBS, 200 μl of 3% BSA (purchased from Shanghai Sangong) was added and incubated for 2 hours. At the same time, 200 μl of 3% BSA was added to a blank 96-well ELISA plate and incubated at 37° C. for 2 hours.
[0065] (3) The random ssDNA library (800 pmol in the first round) was dissolved in 200 μl 1*SHCMK, and denatured at 95° C. for 5 minutes. Immediately place it on ice for 10 minutes, and let it cool down to room temperature rapidly to avoid renaturation of ssDNA into double strands.
[0066] (4) Add...
Embodiment 3
[0078] Embodiment 3 degradation activity analysis
[0079] Human serum albumin, DUSP-1 protein, DUSP-10 protein, DUSP-14, and 22 aptamers were used for specific detection. After binding experiments, it was found that none of these aptamers combined with these proteins, but only Binding to DUSP-9 protein maintains high specificity.
[0080] 0.2ug of the aptamer was taken and placed in normal temperature serum and aqueous solution respectively for two weeks. Through RT-PCR detection, it was found that its structure was stable and not degraded after three weeks of storage.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 