Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Reagent kit for detecting clear renal cell carcinoma

A technology of clear cell renal cell carcinoma and kit, which is applied in the field of detection kits for clear cell renal cell carcinoma, which can solve the problems of complex preparation, high requirements for antibody preparation, and detection limitations, and achieve the effect of simple preparation

Inactive Publication Date: 2016-10-12
孟繁好
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, the amount of DUSP-9 protein has been detected by ELISA after antibody binding. However, this detection method needs to prepare corresponding antibodies. Due to the relatively high requirements and complicated preparation of antibodies, in Significant limitations exist in detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit for detecting clear renal cell carcinoma
  • Reagent kit for detecting clear renal cell carcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1: the acquisition of albumen

[0059] According to the eukaryotic expression method in the prior art, the corresponding protein is obtained. For example, using a method similar to that in (Using Insect Baculovirus to Express DUSP1 and Its Effect on Tumor Cells), the protein was harvested, and a protein stock solution with a DUSP-9 protein concentration of 50 mg / mL was obtained by protein concentration technology.

Embodiment 2

[0060] Example 2 Nucleic Aptamer Screening

[0061] From a random oligomeric DNA library synthesized in vitro, (5'-TTGACAGGGAGCATTAGCAT-N35-GCATTACCATGAAGTTGCAC-3'), wherein N35 is 35 random oligonucleotides;

[0062] Primer P1: TTGACAGGGAGCATTAGCAT; Primer P2: GTGCAACTTCATGGTAATGC.

[0063] (1) 1 mg of DUSP-9 protein was dissolved in 200 μl of PBS, added to a 96-well ELISA plate, and left overnight at 4°C.

[0064] (2) After the protein-coated wells were washed 6 times with PBS, 200 μl of 3% BSA (purchased from Shanghai Sangong) was added and incubated for 2 hours. At the same time, 200 μl of 3% BSA was added to a blank 96-well ELISA plate and incubated at 37° C. for 2 hours.

[0065] (3) The random ssDNA library (800 pmol in the first round) was dissolved in 200 μl 1*SHCMK, and denatured at 95° C. for 5 minutes. Immediately place it on ice for 10 minutes, and let it cool down to room temperature rapidly to avoid renaturation of ssDNA into double strands.

[0066] (4) Add...

Embodiment 3

[0078] Embodiment 3 degradation activity analysis

[0079] Human serum albumin, DUSP-1 protein, DUSP-10 protein, DUSP-14, and 22 aptamers were used for specific detection. After binding experiments, it was found that none of these aptamers combined with these proteins, but only Binding to DUSP-9 protein maintains high specificity.

[0080] 0.2ug of the aptamer was taken and placed in normal temperature serum and aqueous solution respectively for two weeks. Through RT-PCR detection, it was found that its structure was stable and not degraded after three weeks of storage.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a reagent kit for detecting clear renal cell carcinoma. The clear renal cell carcinoma is carcinoma being high in proportion of carcinoma of the kidney, but a detection method has a certain limitation and is not suitable for inexpensive and massive popularization. According to the reagent kit provided by the invention, the content of DUSP-9 protein in samples can be idiosyncratically detected, so that the clear renal cell carcinoma can be rapidly and efficiently detected. The reagent kit is simple to prepare, low in cost, and suitable for large-area popularization and application.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a kit for detecting renal clear cell carcinoma. Background technique [0002] Kidney cancer, also known as renal cell carcinoma, arises from the epithelium of the urinary tubules. Kidney cancer accounts for about 80%-90% of adult malignant tumors. Renal cell carcinoma is usually divided into 4 types: clear cell type, granular cell type, mixed cell type, and undifferentiated cell type. Among them, clear cell renal cell carcinoma (CCRCC) accounts for 70%-80% of renal cancers, and its cancer cells are often arranged in sheets, cords, acini, or tubes, much like renal tubules. Often asymptomatic, or only with systemic symptoms such as fever and fatigue, it is discovered when the tumor volume increases (J.C.Cheville, et al. Comparisons of outcome and prognostic features among histologic subtypes of renal cell carcinoma. The American journal of surgical pathology 27(2003) 612-624). The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/574
CPCG01N33/57407G01N33/57438
Inventor 孟繁好
Owner 孟繁好
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products