Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular markers and specific primers and applications for assisting rf gene selection

A molecular marker and gene selection technology, which can be used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. The effect of saving manpower and material resources and making accurate judgments

Active Publication Date: 2019-08-27
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The restoration of male sterility in pepper is mainly controlled by the main gene Rf (Fertility restorer) located on chromosome 6 of pepper. The pepper CMS restorer line requires test cross evaluation during the breeding process, and the long breeding cycle limits the application of pepper CMS

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular markers and specific primers and applications for assisting rf gene selection
  • Molecular markers and specific primers and applications for assisting rf gene selection
  • Molecular markers and specific primers and applications for assisting rf gene selection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] A BC constructed by backcrossing pepper sterile parent 77013A, fertile parent 0601M and its F1 with 77013 multiple times 5 f 2 The population ((77013A×0601M)×77013) was the test material.

[0017] Genetic Population Construction of Capsicum Rf Gene

[0018] F1 was obtained by crossing the pepper sterile parent 77013A (Capsicum annuum L.) and the pepper restorer line material 0601M (Capsicum annuum L.) as parents, and the BC obtained by backcrossing F1 and 77013 multiple times 5 f 2 The population ((77013A×0601M)×77013) is a mapping population, with a total of 741 individual plants.

[0019] 1. Genomic DNA extraction

[0020] Genomic DNA of all individual BC5F2 plants, parents and F1 was extracted by CTAB method, the concentration and quality were measured by Biospec-nano micro-spectrophotometer, and the concentration was diluted to 100ng / μl.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to the field of molecular markers, in particular to a molecular marker for aiding selection of a Rf (fertility restorer) gene, specific primers and an application. The genetic distance between the molecular marker and the Rf gene is 0.7cM, and the molecular marker is closely linked with the gene. Specific upstream and downstream primers of the molecular marker are as follows: the sequence of the upstream primer of MI16 is CCTCGAATATAAACTTATGGTGTCC, and the sequence of the downstream primer of MI16 is GCTTGGCAACCTATTCTTAGAAGTT. The M16 marker can quickly identify the Rf gene in a sweet pepper, and better complement the study of the sweet pepper in the direction of male sterility.

Description

technical field [0001] The invention relates to the field of molecular markers, in particular to molecular markers, specific primers and applications for assisting Rf gene selection. Background technique [0002] The use of cytoplasmic male sterility (CMS, Cytoplasmic male sterility) three-line hybrid seed production is an effective method to save the cost of artificial detasseling in pepper seed production. Since the production of pepper is based on the fruit, if the male sterile restorer line of the male parent is not strong in fertility recovery, it will lead to insufficient fruit seeds, which will seriously affect the hybrid F. 1 The appearance and yield of commercial pepper fruit. Therefore, the breeding of cytoplasmic male sterile male parent (restorer line) with strong restorative ability is one of the key issues in the utilization of pepper CMS. [0003] The restoration of male sterility in pepper is mainly controlled by the main gene Rf (Fertility restorer) locate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
Inventor 张正海王立浩张宝玺曹亚从朱砚姝
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products