Tumor vascular endothelial cell marker 8 mutant, its fusion protein and application

A technology of endothelial cells and fusion proteins, applied in the field of molecular biology, can solve the problem of no progress in TEM8 structural research

Active Publication Date: 2019-10-25
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The crystal structures of CMG2 monomer and CMG2-PA complex have been reported abroad, but there has been no progress in the structural study of TEM8

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor vascular endothelial cell marker 8 mutant, its fusion protein and application
  • Tumor vascular endothelial cell marker 8 mutant, its fusion protein and application
  • Tumor vascular endothelial cell marker 8 mutant, its fusion protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Expression of TEM8 mutant MT4

[0036] 1. Expression plasmid construction of mutant MT4

[0037] Using L56A-PHAT2 as a template, mutate the 152, 154-159 amino acids by inverse PCR technology, the reaction system is 50 μL, see Table 1 for details.

[0038] Table 1. PCR reaction system (1)

[0039]

[0040] The reaction conditions are:

[0041]

[0042] The PCR product was digested as a template, then phosphorylated and ligated overnight; transformed into DH5α competent cells, spread on LB plates containing Amp, and cultured until clonal growth.

[0043] Primer sequence:

[0044] MT4-R: GCCATCGAGTTTTTCCATCAGTCAAAGCAATGATG

[0045] MT4-F: CTGGTGCCGAGCTATTCAGAGAGGGAGGCTAATAG

[0046] 2. Protein expression and purification

[0047] Transform the MT4-PHAT2 plasmid that has been sequenced and confirmed to have the correct sequence into BL21 Escherichia coli competent, smear the plate and wait for the clones to grow out, pick a single clone and culture it ...

Embodiment 2

[0067] Example 2 Expression and analysis of HAS-MT4 fusion protein

[0068] 1. Construction of HSA and MT4 fusion protein

[0069] Fusion with HSA is a commonly used method to extend protein half-life. In order to construct the HSA-MT4 fusion protein more conveniently, we modified the existing yeast expression plasmid pMEX9K-HSA-CMG2, and inserted two unique restriction enzyme sites of NgoMIV and SpeI between the linker and CMG2, Use one of the restriction enzyme sites and the existing NotI on the plasmid to connect MT4 into the expression vector, as shown in the schematic diagram Image 6 shown.

[0070] The PCR process includes two steps: the first step is to add NgoMIV / SpeI and NotI restriction sites at both ends of MT4. The reaction system was 50 μL, see Table 2 for details.

[0071] Table 2. PCR reaction system (2)

[0072]

[0073] The reaction conditions are:

[0074]

[0075] The second step of PCR is to add the NgoMIV / SpeI restriction site after the HSA-CM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein mutant of a tumor vascular endothelial cell marker 8, a fusion protein of the protein mutant and human serum albumin and application thereof in preparation of drugs for treatment and / or prevention of anthrax infection. The protein mutant disclosed by the invention significantly increases the affinity with an anthrax PA antigen, has similar inhibitory activity to anthrax toxin with sCMG2, has 100% protection rate on rats attached by anthrax toxin LeTx. When the protein mutant is fused with human serum albumin, the half-life in vivo is extended by nearly 10 times, and the fusion protein can completely protect test animals attacked by anthrax toxin LeTx in 14 days.

Description

technical field [0001] The invention discloses a recombinant fusion protein, which belongs to the field of molecular biology. Background technique [0002] Anthrax is a severe zoonotic infectious disease caused by Bacillus anthracis infection. Anthrax toxin is one of the main virulence factors of Bacillus anthracis, which contains three protein components: Protective Antigen (PA), Lethal Factor (LF) and Edema Factor (EF). Anthrax toxin through PA and the receptor tumor vascular endothelial cell marker 8 (Tumor Endothelial Marker 8 / Anthrax Toxin Receptor 1, TEM8) or capillary morphogenesis protein 2 (Capillary Morphogenesis Protein 2 / Anthrax Toxin Receptor 2, CMG2) on the target cells Binding mediates the entry of LF and EF into the cell to play a role, so blocking the binding of PA to receptors is an important target for the research of anthrax toxin inhibitors. Both CMG2 and TEM8 are single transmembrane proteins that bind to PA through the vWA domain of the extracellular...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/47C07K19/00C12N15/12C12N15/81C12N1/19A61K47/62A61K39/00A61P31/04C12R1/84
CPCA61K39/00C07K14/4748C07K14/765C07K2319/00C12N15/815C12N2800/102
Inventor陈薇徐俊杰李亮亮郭强张军董大勇殷瑛蔡晨光付玲
OwnerINST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE