DNA Structure Probe Based on Nucleic Acid Isothermal Amplification Technology to Detect Mercury Ions

A constant temperature amplification and technical detection technology, applied in the field of DNA structure probes, can solve the problems of reduced effect of mercury ion and thymine interaction, low detection sensitivity of trace mercury ions, affecting the application of nucleic acid constant temperature amplification method, etc. Nucleic acid amplification efficiency, easy operation, and the effect of avoiding interference

Inactive Publication Date: 2020-01-21
XI AN JIAOTONG UNIV +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existence of biothiol molecules will compete with thymine to capture trace mercury ions in the system, resulting in a decrease in the interaction between mercury ions and thymine, resulting in low detection sensitivity of trace mercury ions, which affects the nucleic acid constant temperature amplification method. detection applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA Structure Probe Based on Nucleic Acid Isothermal Amplification Technology to Detect Mercury Ions
  • DNA Structure Probe Based on Nucleic Acid Isothermal Amplification Technology to Detect Mercury Ions
  • DNA Structure Probe Based on Nucleic Acid Isothermal Amplification Technology to Detect Mercury Ions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0022] The present invention is described in detail below in conjunction with accompanying drawing.

[0023] The DNA structure probe for detecting mercury ions based on nucleic acid constant temperature amplification technology includes the nucleic acid sequences of three DNA structure probes that contain mismatch sites and can form a triple hybridization structure through nucleic acid hybridization. The nucleotide sequence (5' to 3 '):

[0024] 3-WJ probe 1AGAGGTAGTAGGTGATAGTCGG

[0025] 3-WJ probe 2CCGTCTTTTCTCCCCATAT

[0026] 3-WJ template: TGAGGCTAGAGCGAGCTGAGGCGGATATGGAATACTACCTCTAAA.

[0027] Working principle of the present invention is:

[0028] The DNA structure probe of the present invention utilizes nucleic acid constant temperature amplification technology to detect mercury ions, and the steps are as follows:

[0029] (1) Mix the nucleic acid sequences of three DNA structure probes containing mismatch sites and capable of forming a triple hybridization structur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

DNA structure probes based on nucleic acid constant temperature amplification technology to detect mercury ions, including nucleic acid sequences of three DNA structure probes that contain mismatch sites and can form a triple hybridization structure through nucleic acid hybridization. The triple hybridization structure is characterized by being triggered by mercury ions The DNA probe structure is formed by hybridization, which spatially separates the mercury ion binding region and the polymerase recognition region, and uses the rapid polymerization of the polymerase to obtain a stable structure for sustainable polymerization before the biothiol molecule destroys the interaction between mercury ions and thymine , cleverly avoided the interference of biothiol molecules. This method can effectively eliminate the loss of trace mercury ions due to the interference of biothiol molecules when the nucleic acid constant temperature method is used to detect, effectively improve the detection efficiency of trace mercury ions without introducing any reagents, and further improve the detection efficiency of nucleic acid. Application of isothermal amplification technology in the detection of mercury ions.

Description

technical field [0001] The invention belongs to the trace detection of mercury ions in the field of biotechnology, in particular to a DNA structure probe for detecting mercury ions based on nucleic acid constant temperature amplification technology. [0002] technical background [0003] Heavy metal ions have high stability in the environment and are difficult to be degraded by microorganisms. Once they enter the environment, they are difficult to be repaired naturally, and can be continuously enriched and passed on in the ecosystem. Even a small amount of ingestion can cause great toxicity, which is a major threat to ecological balance and human health. As a typical representative of heavy metal ion pollution, the accumulation of mercury ions in biological tissues causes DNA damage, affects ligand-receptor interactions, destroys the immune system, and causes a series of diseases, such as brain damage, kidney failure, various cognition and movement disorders. Therefore, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6844C12N15/11
CPCC12Q1/6844C12Q2563/107
Inventor赵永席赵越刘华青袁慧董绘阳白凯王芳霞杨卫军魏帅
OwnerXI AN JIAOTONG UNIV