Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for identifying natural crocodile-skin leather

A crocodile and leather technology, applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve problems such as infrared spectrum interference

Inactive Publication Date: 2016-11-16
GUANGZHOU PONY TESTING TECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Infrared spectroscopy uses the difference in amino acid types and composition ratios in leather to irradiate the surface of leather samples with continuous wavelength infrared light, causing molecular vibrations and transitions between energy levels, and obtaining different spectra in the infrared absorption spectrum, but currently There are only common detection methods for pig, cattle, sheep, horse and other leathers
In addition, more chemical reagents will be added in the process of leather processing, and the coating on the leather surface will greatly interfere with the infrared spectrum, so this method is still in the exploratory stage in the identification of finished leather
[0006] The DNA identification method is to extract the DNA of animal sources in leather products, design primers for the specific gene sequence of the species, obtain the gene sequence of the target species through PCR amplification of the specific gene, and use real-time fluorescent PCR method or sequencing comparison according to the amplification product. Equivalent molecular biotechnology is used to determine the animal-derived components of leather, but there is no report on the identification of natural crocodile leather using DNA identification methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying natural crocodile-skin leather
  • Method for identifying natural crocodile-skin leather
  • Method for identifying natural crocodile-skin leather

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Verification of the accuracy of crocodile-specific gene detection primers and probes

[0037] 1. Design primers and probes for crocodile-specific gene detection:

[0038]Using the GenBank database (https: / / www.ncbi.nlm.nih.gov / genbank / ) to analyze Crocodylus porosus, Crocodylus siamensis, Nile crocodile (Crocodylus niloticus), American crocodile (Crocodylus acutus) , Cuban crocodile (Crocodylus rhombifer) and Orenac crocodile (Crocodylus intermedius) were analyzed by bioinformatics, and appropriate crocodile-specific genes were selected as objects, and real-time fluorescent PCR specific amplification primers and probes were designed and synthesized, respectively:

[0039] Upstream primer P1: GGATGAACAGTCTAYCCA

[0040] Downstream primer P2: GCCGTGGTAATAAARTTAA

[0041] The sequence of the probe with fluorescent dye is: CCACGCCGGACCATCAGTAG

[0042] The 5' end of the above-mentioned fluorescent dyes is labeled with FAM, and the 3' end is labeled with TAMRA....

Embodiment 2

[0074] Example 2: Specific verification of crocodile-specific gene detection primers and probes

[0075] 1. Primers and probes used:

[0076] Primer probes for real-time fluorescent PCR detection of crocodile-specific genes are:

[0077] Upstream primer P1: GGATGAACAGTCTAYCCA

[0078] Downstream primer P2: GCCGTGGTAATAAARTTAA

[0079] The sequence of the probe with fluorescent dye is: CCACGCCGGACCATCAGTAG

[0080] The 5' end of the above-mentioned fluorescent dyes is labeled with FAM, and the 3' end is labeled with TAMRA.

[0081] The primers and probes for detecting the 18SrRNA gene by real-time fluorescent PCR are:

[0082] Upstream primer P1: TCTGCCCTATCAACTTTCGATGGTA

[0083] Downstream primer P2: AATTTGCGCGCCTGCTGCCTTCCTT

[0084] The sequence of the probe with fluorescent dye is: CCGTTTCTCAGGCTCCCCTCTCCGGAATCGAACC

[0085] The 5' end of the above-mentioned fluorescent dyes is labeled with FAM, and the 3' end is labeled with TAMRA.

[0086] 2. The extraction and p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for identifying natural crocodile-skin leather and particularly relates to a primer for identifying natural crocodile-skin leather with the real-time fluorescence PCR technology, a probe and a concrete detection method. High sensitivity and specificity are achieved, and whether leather is natural crocodile-skin leather or not can be quickly and accurately identified with the combination of the identifying method.

Description

Technical field: [0001] The invention belongs to the field of leather detection, and specifically relates to a primer and a probe for real-time fluorescent PCR detection and a method for identifying natural crocodile leather by using the primer probe. Background technique [0002] Leather is denatured and non-perishable animal skin obtained through physical and chemical processing such as depilation and tanning. The price of leather is relatively high, and the factors affecting its price are not only the processing technology, but also the type of leather or fur used. Among them, crocodile leather can be called the platinum in leather, and is famous for its luxury and rarity. This is not only because of the scarcity of crocodiles, but also because of the slow growth rate of crocodiles and the high cost of breeding, and the usable crocodile skin is limited to the long and narrow part of the crocodile's abdomen. Crocodile leather has a natural gradient grid pattern and is du...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q1/686C12Q2561/113C12Q2563/107
Inventor 宋薇张斌崔山闫涛郭文宗
Owner GUANGZHOU PONY TESTING TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products