Method for identifying natural crocodile-skin leather
A crocodile and leather technology, applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve problems such as infrared spectrum interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1: Verification of the accuracy of crocodile-specific gene detection primers and probes
[0037] 1. Design primers and probes for crocodile-specific gene detection:
[0038]Using the GenBank database (https: / / www.ncbi.nlm.nih.gov / genbank / ) to analyze Crocodylus porosus, Crocodylus siamensis, Nile crocodile (Crocodylus niloticus), American crocodile (Crocodylus acutus) , Cuban crocodile (Crocodylus rhombifer) and Orenac crocodile (Crocodylus intermedius) were analyzed by bioinformatics, and appropriate crocodile-specific genes were selected as objects, and real-time fluorescent PCR specific amplification primers and probes were designed and synthesized, respectively:
[0039] Upstream primer P1: GGATGAACAGTCTAYCCA
[0040] Downstream primer P2: GCCGTGGTAATAAARTTAA
[0041] The sequence of the probe with fluorescent dye is: CCACGCCGGACCATCAGTAG
[0042] The 5' end of the above-mentioned fluorescent dyes is labeled with FAM, and the 3' end is labeled with TAMRA....
Embodiment 2
[0074] Example 2: Specific verification of crocodile-specific gene detection primers and probes
[0075] 1. Primers and probes used:
[0076] Primer probes for real-time fluorescent PCR detection of crocodile-specific genes are:
[0077] Upstream primer P1: GGATGAACAGTCTAYCCA
[0078] Downstream primer P2: GCCGTGGTAATAAARTTAA
[0079] The sequence of the probe with fluorescent dye is: CCACGCCGGACCATCAGTAG
[0080] The 5' end of the above-mentioned fluorescent dyes is labeled with FAM, and the 3' end is labeled with TAMRA.
[0081] The primers and probes for detecting the 18SrRNA gene by real-time fluorescent PCR are:
[0082] Upstream primer P1: TCTGCCCTATCAACTTTCGATGGTA
[0083] Downstream primer P2: AATTTGCGCGCCTGCTGCCTTCCTT
[0084] The sequence of the probe with fluorescent dye is: CCGTTTCTCAGGCTCCCCTCTCCGGAATCGAACC
[0085] The 5' end of the above-mentioned fluorescent dyes is labeled with FAM, and the 3' end is labeled with TAMRA.
[0086] 2. The extraction and p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 