Long non-coding RNA and application thereof

A long-chain non-coding, non-coding technology, applied in the direction of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of not finding colorectal cancer IncRNA and so on

Inactive Publication Date: 2016-11-30
HUZHOU CENT HOSPITAL
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no discovery of related IncRNAs and their functions in colorectal cancer. This application first confirmed the IncRNAs that can be used as diagnostic markers and therapeutic targets in colorectal cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Long non-coding RNA and application thereof
  • Long non-coding RNA and application thereof
  • Long non-coding RNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Detection of TUC338 Expression in Colorectal Cancer Tissue Samples

[0021] 1) Fresh cancer tissues and their corresponding paracancerous tissues (beyond the resection margin of 3cm) were selected from 17 patients with colorectal cancer who were diagnosed with colon cancer or rectal cancer by surgery. Chemotherapy, radiotherapy and other anti-tumor treatments are performed to rule out other systemic diseases and the possibility of metastatic cancer, and the functions of all important organs are within the normal range.

[0022] 2), the synthesis of primers: query in GenBank Blast, find the sequence (SEQID NO: 1) of the target gene TUC338mRNA, apply the express 2.0 software of Primer to design specific primer probes on the CDS region, and the primer probes are synthesized by (company ) synthesis, the primer sequence is as follows:

[0023] Forward (5'-3): GCCCCACCCCCTTCATTCTTA (SEQ ID NO: 2)

[0024] Reverse (5'-3'): CAGACACAATTTGAAACGAGCTG (SEQ ID NO: 3);

...

Embodiment 2

[0057] Embodiment 2 Design and carrier preparation of interfering RNA sequence

[0058] 1) Design interference fragments and negative control sequences according to the sequence information of TUC338, wherein the interference sequences are:

[0059] siRNA-TUC338:

[0060] Sense Seq: 5'-UACAGCACAGGCAGCGACTT-3'; (SEQ ID NO: 2)

[0061] Antisense Seq: 5′-GUCGCUGCCUGUGCUGUATT-3′;

[0062] Negative Control siRNA:

[0063] Sense Seq: 5'-UUGUGCGAAGCUGAUGCUTT-3'; (SEQ ID NO: 7)

[0064] AntiSense Seq 5'-AGCAUCAGCUUCGCACAATT-3'.

[0065] 2) Vector construction

[0066] The above-mentioned fragments are chemically synthesized, and after annealing, they are ligated into the vector pLVX-shRNA1 by enzyme digestion. The method includes:

[0067] a) Annealing of oligonucleotides

[0068] Dilute the synthesized deoxynucleotides to 1 μg / μL, take 5 μL each of the sense strand and the antisense strand and anneal to form a double strand. The reaction system is as follows:

[0069] Sense s...

Embodiment 3

[0089] Example 3 Interference Effect Test of Interfering RNA Carrier

[0090] HT29 cells were used as recipient cells, which were resuscitated before transfection and subcultured; experimental groups were set up, namely interference group (Si), negative control group (NC) and blank control group (Blank).

[0091] 1) Cell transfection

[0092] a) 24 hours before transfection, the cells were replaced with a medium that did not contain any antibiotics;

[0093] b) the cell confluency reaches 70%;

[0094] c) Add 20 μL of the ligation product to 400 μL of serum-free medium, add 5 μL of Lipo2000 transfection reagent, mix well at room temperature, and let stand for 20 minutes;

[0095] d) Set up three replicate wells for each group, add 400 μL of the transfection reagent prepared in the above steps to each well, and place in 5% CO 2 , cultured in a 37°C incubator for 7-8h, and then replaced with normal culture medium.

[0096] e) 24-48 hours after transfection, detect the RNA ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The application obtains a marker through clinical sample screening that can be used as a marker for the diagnosis of colorectal cancer, which is a long-chain non-coding RNA, that is, IncRNA. The sequence of the IncRNA is shown in SEQ ID NO: 1, and it is designed to inhibit The positive RNAi fragment SEQ ID NO: 4 and transfected cells show that the expression of the IncRNA can be reduced, the proliferation and migration of tumor cells can be significantly inhibited, and the apoptosis rate of tumor cells can be increased. It is a potential therapeutic agent.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and specifically relates to the expression of long-chain non-coding RNA in colorectal cancer tissues and cells of digestive tract tumors and its application for preparing and treating the cancer. Background technique [0002] Colorectal cancer is one of the malignant tumors that seriously endanger human health. Among many types of tumors, the research on the molecular mechanism of colorectal cancer was carried out relatively early and relatively clearly. Since Vogelstein proposed the classic multi-step, multi-gene development model of colorectal cancer, the molecular pathology of colorectal cancer has been continuously developed, and a series of genes related to the development of colorectal cancer have been discovered one after another. In the past two decades, with the changes in the lifestyle and diet structure of Chinese residents, the morbidity and mortality of colorectal cancer have ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/113A61K48/00A61K31/7088A61P35/00
CPCC12Q1/6886C12N15/113C12N2310/14C12Q2600/158C12Q2600/178
Inventor金文君
OwnerHUZHOU CENT HOSPITAL