Method for improving gene targeting efficiency and method for carrying out in-situ repair on base on beta-globulin gene locus
An in situ repair, gene locus technology, applied in the fields of plasma globulin/lactoglobulin, genetic engineering, mammalian protein, etc. inefficient effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0070] ssODNs and spCas9-HF1 correct β-globin gene-deficient iPSCs of thalassemia
[0071] The main steps:
[0072] ⑴iPSCs 1×10 6 , 8ug spCas9 / HF1 vector, 2μg ssODN4, Neon Transfection System (Thermo Fisher) transfection system;
[0073] (2) After transfection, put 10 μM Y-27632 inhibitor prepared by mTeSR1 for 24 hours, with or without adding the small molecule compound L755507;
[0074] (3) 48 hours after transfection, use Fluorescence-Activated Cell Sorting (FACS) to sort the cells expressing green fluorescence, and then put them into a 6-well plate to continue culturing for 10 days;
[0075] (4) TIANamp Genomic DNA kit (Tiangen) extracts DNA for PCR analysis, which requires 100ng DNA template and LA Taq (Takara);
[0076] Primer sequence:
[0077] F: 5'ACGGCTGTCATCACTTAGACCT3' (430bp upstream of the mutation site)
[0078] R: 5'TCCCCTTCCTATGACATGAACT3' (243bp downstream of the mutation site)
[0079] R wt (5'TCCCCAAAGGACTCAAAGAACC 3')
[0080] R Δ (5'AGATCCCCAAAGG...
Embodiment 2
[0083] ssODNs and spCas9-HF1 correct β-globin gene-deficient iPSCs of thalassemia
[0084] The main steps:
[0085] ⑴iPSCs 1×10 6 , 8ug spCas9 / HF1 vector, 2μg ssODN4, Neon Transfection System (Thermo Fisher) transfection system;
[0086] (2) After transfection, put 10 μM Y-27632 inhibitor prepared by mTeSR1 for 12 hours, with or without adding the small molecule compound L755507;
[0087] (3) 36 hours after transfection, use Fluorescence-Activated Cell Sorting (FACS) to sort the cells expressing green fluorescence, and then put them into a 6-well plate to continue culturing for 10 days;
[0088] (4) TIANamp Genomic DNA kit (Tiangen) extracts DNA for PCR analysis, which requires 100ng DNA template and LA Taq (Takara);
[0089] Primer sequence:
[0090] F: 5'ACGGCTGTCATCACTTAGACCT3' (430bp upstream of the mutation site)
[0091] R: 5'TCCCCTTCCTATGACATGAACT3' (243bp downstream of the mutation site)
[0092] R wt (5'TCCCCAAAGGACTCAAAGAACC 3')
[0093] R Δ (5'AGATCCCCAAAGG...
Embodiment 3
[0096] ssODNs and spCas9-HF1 correct β-globin gene-deficient iPSCs of thalassemia
[0097] The main steps:
[0098] ⑴iPSCs 1×10 6 , 8ug spCas9 / HF1 vector, 2μg ssODN4, Neon Transfection System (Thermo Fisher) transfection system;
[0099] (2) After transfection, put 10 μM Y-27632 inhibitor prepared by mTeSR1 for 48 hours, with or without adding the small molecule compound L755507;
[0100] (3) 72 hours after transfection, use Fluorescence-Activated Cell Sorting (FACS) to sort the cells expressing green fluorescence, and then put them into a 6-well plate to continue culturing for 10 days;
[0101] (4) TIANamp Genomic DNA kit (Tiangen) extracts DNA for PCR analysis, which requires 100ng DNA template and LA Taq (Takara);
[0102] Primer sequence:
[0103]F: 5'ACGGCTGTCATCACTTAGACCT3' (430bp upstream of the mutation site)
[0104] R: 5'TCCCCTTCCTATGACATGAACT3' (243bp downstream of the mutation site)
[0105] R wt (5'TCCCCAAAGGACTCAAAGAACC 3')
[0106] R Δ (5'AGATCCCCAAAGGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More