Method for improving gene targeting efficiency and method for carrying out in-situ repair on base on beta-globulin gene locus

An in situ repair, gene locus technology, applied in the fields of plasma globulin/lactoglobulin, genetic engineering, mammalian protein, etc. inefficient effect

Inactive Publication Date: 2016-12-21
THE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY
View PDF6 Cites 38 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to its own triplet properties, its design is more cumbersome than TALEN, and it is highly dependent on the target sequence and its upstream and downstream sequences, and has many limiting factors such as high off-target rate and high cytotoxicity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] ssODNs and spCas9-HF1 correct β-globin gene-deficient iPSCs of thalassemia

[0071] The main steps:

[0072] ⑴iPSCs 1×10 6 , 8ug spCas9 / HF1 vector, 2μg ssODN4, Neon Transfection System (Thermo Fisher) transfection system;

[0073] (2) After transfection, put 10 μM Y-27632 inhibitor prepared by mTeSR1 for 24 hours, with or without adding the small molecule compound L755507;

[0074] (3) 48 hours after transfection, use Fluorescence-Activated Cell Sorting (FACS) to sort the cells expressing green fluorescence, and then put them into a 6-well plate to continue culturing for 10 days;

[0075] (4) TIANamp Genomic DNA kit (Tiangen) extracts DNA for PCR analysis, which requires 100ng DNA template and LA Taq (Takara);

[0076] Primer sequence:

[0077] F: 5'ACGGCTGTCATCACTTAGACCT3' (430bp upstream of the mutation site)

[0078] R: 5'TCCCCTTCCTATGACATGAACT3' (243bp downstream of the mutation site)

[0079] R wt (5'TCCCCAAAGGACTCAAAGAACC 3')

[0080] R Δ (5'AGATCCCCAAAGG...

Embodiment 2

[0083] ssODNs and spCas9-HF1 correct β-globin gene-deficient iPSCs of thalassemia

[0084] The main steps:

[0085] ⑴iPSCs 1×10 6 , 8ug spCas9 / HF1 vector, 2μg ssODN4, Neon Transfection System (Thermo Fisher) transfection system;

[0086] (2) After transfection, put 10 μM Y-27632 inhibitor prepared by mTeSR1 for 12 hours, with or without adding the small molecule compound L755507;

[0087] (3) 36 hours after transfection, use Fluorescence-Activated Cell Sorting (FACS) to sort the cells expressing green fluorescence, and then put them into a 6-well plate to continue culturing for 10 days;

[0088] (4) TIANamp Genomic DNA kit (Tiangen) extracts DNA for PCR analysis, which requires 100ng DNA template and LA Taq (Takara);

[0089] Primer sequence:

[0090] F: 5'ACGGCTGTCATCACTTAGACCT3' (430bp upstream of the mutation site)

[0091] R: 5'TCCCCTTCCTATGACATGAACT3' (243bp downstream of the mutation site)

[0092] R wt (5'TCCCCAAAGGACTCAAAGAACC 3')

[0093] R Δ (5'AGATCCCCAAAGG...

Embodiment 3

[0096] ssODNs and spCas9-HF1 correct β-globin gene-deficient iPSCs of thalassemia

[0097] The main steps:

[0098] ⑴iPSCs 1×10 6 , 8ug spCas9 / HF1 vector, 2μg ssODN4, Neon Transfection System (Thermo Fisher) transfection system;

[0099] (2) After transfection, put 10 μM Y-27632 inhibitor prepared by mTeSR1 for 48 hours, with or without adding the small molecule compound L755507;

[0100] (3) 72 hours after transfection, use Fluorescence-Activated Cell Sorting (FACS) to sort the cells expressing green fluorescence, and then put them into a 6-well plate to continue culturing for 10 days;

[0101] (4) TIANamp Genomic DNA kit (Tiangen) extracts DNA for PCR analysis, which requires 100ng DNA template and LA Taq (Takara);

[0102] Primer sequence:

[0103]F: 5'ACGGCTGTCATCACTTAGACCT3' (430bp upstream of the mutation site)

[0104] R: 5'TCCCCTTCCTATGACATGAACT3' (243bp downstream of the mutation site)

[0105] R wt (5'TCCCCAAAGGACTCAAAGAACC 3')

[0106] R Δ (5'AGATCCCCAAAGGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for improving the gene targeting efficiency and a method for carrying out in-situ repair on the base on a beta-globulin gene locus. The method for improving the gene targeting efficiency comprises the following steps of: S10, determining a gene locus to undergo in-situ repair; and S20, introducing a CRISPR / Ca system to cleave editing lotus DNA to cause DNA damage and simultaneously providing a repair template segment. Based on the deficiency of existing gene modification, the gene modification efficiency, the timeliness and the modification quality are improved after single-stranded oligonucleotides (ss ODNs) and a small molecule compound participate in a CRISPR / Cas9 gene modification system.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for improving the efficiency of gene targeting and a base in situ repair method for a β-globulin gene locus. Background technique [0002] TALEN technology is currently the most commercially successful technology. Although assembling a single TALEN module requires a large number of molecular cloning and sequencing operations, which is very cumbersome, many commercial companies can provide assembled triplet codon TALEN modules, or even quadruple codes. Sub-TALEN modules, which greatly shorten the experimental cycle of building TALEN components. However, it is precisely because of this that it is difficult for most laboratories to complete the complete operation of TALEN technology by themselves, which has caused obstacles to its promotion. [0003] ZFN technology is the earliest genome fixed-point modification technology widely used. All major platforms are relat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/85C12N15/65
CPCC07K14/4717C12N15/65C12N15/8509C12N2800/107C12N2800/80
Inventor范勇李小平杨翌
OwnerTHE THIRD AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL UNIVERSITY