Real-time fluorescence isothermal-amplification primer groups and reaction system and detection method for quantitatively detecting locus rot germ
An isothermal amplification and real-time fluorescence technology, applied in the biological field, to meet the needs of plant disease diagnosis and monitoring, high sensitivity, and strong practicability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0042] specific implementation
[0043] The present invention will be further described in detail below in combination with specific embodiments, so as to help those skilled in the art understand the present invention.
[0044] 1. Primer set design for real-time fluorescent isothermal amplification
[0045] The primer design of the lotus spoilage fungus selects the mitochondrial small subunit (mtSSU rRNAgenes) gene fragment of the lotus spoilage fungus, which has good repeatability and specificity, and the sequence length is about 700bp. Using the online software PrimerExplorerV4 (http: / / primerexplorer.jp / e / ) of Japan Eiken Co., Ltd. to design a specific primer set for the real-time fluorescence isothermal amplification (Real-time LAMP) detection method of lotus spoilage bacteria: including a pair of internal primers ( FIP, BIP) and a pair of outer primers (F3, B3), the primer sequence is as follows:
[0046] F3: CCAGACGGTCAATATAGCTTAT
[0047] B3: TAGTTTTGCTAGGCTAACCCTA ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 