Construction method of virus infectious clone and application thereof
A technology of virus infectivity and construction method, applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of insignificant effect, uncommon effect, large number of inserted introns, etc., to simplify construction and Effects of the inoculation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: Construction of papaya ringspot virus (PRSV) invasive clone
[0034] (1) Design primers for segmented amplification of the PRSV genome and amplify to obtain genomic fragments
[0035] Since the PRSV genome is relatively large (about 10 kb), it is difficult to amplify the entire genome by PCR, so it is designed to be amplified in two segments. Wherein, the primers for amplifying Fragment 1 are:
[0036] Upstream primer (SEQ ID NO: 1):
[0037] AGGAAGTTCATTTCATTTGGAGAGG AAATAAAACATTCTCAACACAACACACAAGT (the underlined sequence is the linker sequence when splicing with the expression vector in vitro);
[0038] Downstream primer (SEQ ID NO:2): TATGTCTCTTGCGTTCTGGCGAATTTC;
[0039]The primer for amplifying Fragment 2 is the upstream primer (SEQ ID NO: 3): AATTCGCCAGAACGCAAGAGACATAC,
[0040] Downstream primer (SEQ ID NO:4):
[0041] CGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTC TCATTCCAAGAGGTTCGAATAAC (the underlined sequence is the linker sequence when splicin...
Embodiment 2
[0054] Embodiment 2: Construction of papaya deformity mosaic virus (PLDMV) invasive clone
[0055] (1) Design primers for segmented amplification of the PLDMV genome and amplify to obtain genomic fragments
[0056] Since the PLDMV genome is relatively large (about 10 kb), it is difficult to amplify the entire genome by PCR, so it is designed to be amplified in two segments. Wherein the primers for amplifying Fragment 1 are:
[0057] Upstream primer (SEQ ID ON:9):
[0058] AGGAAGTTCATTTCATTTGGAGAGG AAAAAATATAAAAACTCAACAAACTTATGC (the underlined sequence is the linker sequence when splicing with the expression vector in vitro),
[0059] Downstream primer (SEQ ID NO: 10): CACATTTCTCGTAATTTTTCCAACC;
[0060] The primer for amplifying Fragment 2 is the upstream primer (SEQ ID NO: 11): GGTTGGAAAAATTACGAGAAATGTG,
[0061] Downstream primer (SEQ ID NO: 12):
[0062] CGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCC TCCTTGCTTAGTCTGAAGTTCC (the underlined sequence is the linker sequence whe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


