Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method of virus infectious clone and application thereof

A technology of virus infectivity and construction method, applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of insignificant effect, uncommon effect, large number of inserted introns, etc., to simplify construction and Effects of the inoculation process

Active Publication Date: 2017-02-15
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The first two methods have the problem that the effect is not common or the effect is not obvious. Although the method of inserting introns can effectively solve the problem of expressing viral toxic proteins in E. coli, the determination of the number and position of inserted introns requires a lot of work. preliminary work or exploration
[0006] Therefore, the prior art has failed to provide a simple and effective method for solving unstable infectious virus clones in Escherichia coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of virus infectious clone and application thereof
  • Construction method of virus infectious clone and application thereof
  • Construction method of virus infectious clone and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Construction of papaya ringspot virus (PRSV) invasive clone

[0034] (1) Design primers for segmented amplification of the PRSV genome and amplify to obtain genomic fragments

[0035] Since the PRSV genome is relatively large (about 10 kb), it is difficult to amplify the entire genome by PCR, so it is designed to be amplified in two segments. Wherein, the primers for amplifying Fragment 1 are:

[0036] Upstream primer (SEQ ID NO: 1):

[0037] AGGAAGTTCATTTCATTTGGAGAGG AAATAAAACATTCTCAACACAACACACAAGT (the underlined sequence is the linker sequence when splicing with the expression vector in vitro);

[0038] Downstream primer (SEQ ID NO:2): TATGTCTCTTGCGTTCTGGCGAATTTC;

[0039]The primer for amplifying Fragment 2 is the upstream primer (SEQ ID NO: 3): AATTCGCCAGAACGCAAGAGACATAC,

[0040] Downstream primer (SEQ ID NO:4):

[0041] CGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTC TCATTCCAAGAGGTTCGAATAAC (the underlined sequence is the linker sequence when splicin...

Embodiment 2

[0054] Embodiment 2: Construction of papaya deformity mosaic virus (PLDMV) invasive clone

[0055] (1) Design primers for segmented amplification of the PLDMV genome and amplify to obtain genomic fragments

[0056] Since the PLDMV genome is relatively large (about 10 kb), it is difficult to amplify the entire genome by PCR, so it is designed to be amplified in two segments. Wherein the primers for amplifying Fragment 1 are:

[0057] Upstream primer (SEQ ID ON:9):

[0058] AGGAAGTTCATTTCATTTGGAGAGG AAAAAATATAAAAACTCAACAAACTTATGC (the underlined sequence is the linker sequence when splicing with the expression vector in vitro),

[0059] Downstream primer (SEQ ID NO: 10): CACATTTCTCGTAATTTTTCCAACC;

[0060] The primer for amplifying Fragment 2 is the upstream primer (SEQ ID NO: 11): GGTTGGAAAAATTACGAGAAATGTG,

[0061] Downstream primer (SEQ ID NO: 12):

[0062] CGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCC TCCTTGCTTAGTCTGAAGTTCC (the underlined sequence is the linker sequence whe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method of a virus infectious clone and the application thereof. The method comprises the steps of amplifying the whole or a segment of a viral genome, linearly processing an expression vector, respectively designing overlapped sequences for in-vitro splicing purpose at the two ends of the genome / each gene fragment and the two ends of the expression vector, conducting the in-vitro splicing for the viral genome or each gene fragment and the linearized expression vector, directly transforming a spliced product into agrobacterium so as to obtain a virus infectious cloned recombinant agrobacterium. The recombinant agrobacterium is used for inoculation, so that the virus systemic infection can be realized. The method is characterized in that, after the viral genome and the expression vector are subjected to in-vitro nucleic acid splicing, the spliced product is transformed into agrobacterium instead of escherichia coli. The virus infectious clone, stable in the agrobacterium, can be obtained. The toxicity or the unstable phenomenon of virus in the escherichia coli can be avoided. Moreover, the construction method is more flexible and more convenient.

Description

technical field [0001] The present invention relates to the fields of virology and molecular biology. Specifically, the present invention relates to a method for constructing a virus-infecting clone and its application. Background technique [0002] Infectious cloning is a fundamental research tool in the field of virology research. The cloned viral genome is easy to manipulate molecularly. Therefore, infectious cloning plays an important role in the study of virus gene function, infection mechanism, and virus-host interaction. Also, infectious clones of viruses can also be used as vectors for gene expression or silencing. [0003] Application No. 201410706857.5 (Infectious Cloning Vector of Cucumber Green Mottle Mosaic Virus, Agrobacterium Strain and Its Preparation and Application) discloses an infectious clone of Cucumber green mottle mosaic virus (CGMMV) The construction method of the virus infection clone is fused to the vector pCB301-CH with 35S promoter and ribozym...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/66
Inventor 言普庹德财付兰兰沈文涛周鹏
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI