Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Function and application of disintegrin-metalloproteinase 23 in treatment on cardiac hypertrophy

A technology for myocardial hypertrophy and heart function, applied in the field of gene function and application, to achieve the effect of inhibiting myocardial hypertrophy and improving heart function

Active Publication Date: 2017-04-05
WUHAN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no report on the role of ADAM23 in cardiovascular diseases, especially cardiac hypertrophy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Function and application of disintegrin-metalloproteinase 23 in treatment on cardiac hypertrophy
  • Function and application of disintegrin-metalloproteinase 23 in treatment on cardiac hypertrophy
  • Function and application of disintegrin-metalloproteinase 23 in treatment on cardiac hypertrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] [Example 1] Effect of ADAM23 interference (AdshADAM23) and overexpression (AdADAM23) adenovirus on Ang II-stimulated primary cardiomyocyte hypertrophy

[0057] 1. Primary neonatal SD rat cardiomyocyte culture

[0058] (1) Eight newborn Sprague-Dawley suckling mice were disinfected with 75% alcohol below the neck, and the heart was removed with ophthalmic scissors and micro forceps, and placed in a glass plate filled with 10mL DMEM / F12 solution. Take another one and repeat the above process.

[0059] (2) Wash the heart with DMEM / F12 medium, and cut the heart into 1-2mm 3 fragments. Transfer to a serum bottle with a rotor, suck off DMEM / F12, and add trypsin digestion solution. Rotate at 120r / min, digest for 15min, rest for a few seconds, and discard the supernatant.

[0060] (3) Add trypsin digestion solution, the rotation speed is 120r / min, and digest for 15min. Stand still for a few seconds, draw the supernatant, terminate the digestion with DMEM / F12 medium with 20...

Embodiment 2

[0077] [Example 2] Construction of heart-specific ADAM23 knockout mice and ADAM23 transgenic mice:

[0078] (1) Construction of cardiac-specific ADAM23 knockout mice (see figure 2 A):

[0079] According to gene information, using CRISPR Design (URL: http: / / crispr.mit.edu / ) to design a CRISPR targeting site in intron 2 and 3 respectively. The target sequences are:

[0080] ADAM23-sgRNA1: gGTACAATTTATCTCCGTCACTT TGG

[0081] ADAM23-sgRNA2: GGAGACTTGAAGGGGAATAGGAT GGG

[0082] In addition, a donor plasmid (Donor Vector) for homology repair was designed, which includes homology arms on both sides, exon 3 in the middle and two loxp sequences in the same direction.

[0083] ①Construction of targeting vector: The two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, and then ligated into pUC57-sgRNA vector treated with restriction endonuclease BsaI with T4 DNA ligase. There is a T7 promoter upstream of the vector, which can be used for subsequen...

Embodiment 3

[0104] [Example 3] Myocardial hypertrophy model acquisition

[0105] 1. Grouping of experimental animals: male background C57BL / 6 cardiac-specific Cre mice (α-MHC-Cre (WT), cardiac-specific ADAM23 knockout mice (ADAM23-KO) and cardiac-specific ADAM23 transgenic mice ( TG) and non-transgenic mice (NTG), established cardiac hypertrophy model by aortic coarctation. Randomly divided into 8 groups, grouped as follows: C57BL / 6 background wild-type mice sham operation group (WT Sham) and AB operation group (WT AB), ADAM23 knockout mouse sham operation group (ADAM23-KOSham) and AB operation group (ADAM23-KO AB), non-transgenic mouse sham operation group (NTG Sham) and AB operation group (NTG AB), Cardiac-specific ADAM23 transgenic mice sham operation group (TG Sham) and AB operation group (TG AB).

[0106] 2. The myocardial hypertrophy model adopts aortic arch coarctation (AB) surgery, and the operation process of the model is as follows:

[0107] 2.1 Preoperative preparation

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a function and application of disintegrin-metalloproteinase 23 (ADAM23) in treatment on cardiac hypertrophy. ADAM23 has the effects of inhibiting cardiac hypertrophy and fibrosis and improving cardiac functions in a model of myocardial hypertrophy caused by aortic coarctation and Ang II stimulation. Therefore, the ADAM23 gene can be used as a drug target in screening of drugs for cardiac function protection, cardiac fibrosis resistance and / or prevention, alleviation and / or treatment on cardiac hypertrophy. ADAM23 can be used to prepare drugs for protection of cardiac functions, cardiac fibrosis resistance and / or prevention, alleviation and / or treatment on cardiac hypertrophy and provides a novel approach for treatment on cardiac hypertrophy.

Description

technical field [0001] The invention belongs to the field of gene function and application, in particular to the function and application of a disintegrin and metalloproteinase 23 (ADAM23) in the treatment of myocardial Use in hypertrophic drugs. Background technique [0002] Myocardial hypertrophy is an adaptive compensatory response of myocardial cells to the stimulation of neurohumoral factors and changes in mechanical stress load. It is a complex and dynamic process that incorporates many factors involved in regulation. Cardiomyopathy, cardiomyopathy and other common pathological processes that need to be experienced in the development of most cardiovascular diseases[1]. Myocardial hypertrophy is an adaptive compensatory response of the heart to various cardiovascular stimuli such as hemodynamic load, angiotensin, growth factors, and hormones, which can reduce the pressure on the ventricular wall and maintain or even increase cardiac output. However, long-term stress w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68A61K38/48A61P9/00A61P9/04
CPCA61K38/48G01N33/68G01N33/6893
Inventor 李红良陈曼华向梅邓克穷
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com