Function and application of disintegrin-metalloproteinase 23 in treatment on cardiac hypertrophy
A technology for myocardial hypertrophy and heart function, applied in the field of gene function and application, to achieve the effect of inhibiting myocardial hypertrophy and improving heart function
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] [Example 1] Effect of ADAM23 interference (AdshADAM23) and overexpression (AdADAM23) adenovirus on Ang II-stimulated primary cardiomyocyte hypertrophy
[0057] 1. Primary neonatal SD rat cardiomyocyte culture
[0058] (1) Eight newborn Sprague-Dawley suckling mice were disinfected with 75% alcohol below the neck, and the heart was removed with ophthalmic scissors and micro forceps, and placed in a glass plate filled with 10mL DMEM / F12 solution. Take another one and repeat the above process.
[0059] (2) Wash the heart with DMEM / F12 medium, and cut the heart into 1-2mm 3 fragments. Transfer to a serum bottle with a rotor, suck off DMEM / F12, and add trypsin digestion solution. Rotate at 120r / min, digest for 15min, rest for a few seconds, and discard the supernatant.
[0060] (3) Add trypsin digestion solution, the rotation speed is 120r / min, and digest for 15min. Stand still for a few seconds, draw the supernatant, terminate the digestion with DMEM / F12 medium with 20...
Embodiment 2
[0077] [Example 2] Construction of heart-specific ADAM23 knockout mice and ADAM23 transgenic mice:
[0078] (1) Construction of cardiac-specific ADAM23 knockout mice (see figure 2 A):
[0079] According to gene information, using CRISPR Design (URL: http: / / crispr.mit.edu / ) to design a CRISPR targeting site in intron 2 and 3 respectively. The target sequences are:
[0080] ADAM23-sgRNA1: gGTACAATTTATCTCCGTCACTT TGG
[0081] ADAM23-sgRNA2: GGAGACTTGAAGGGGAATAGGAT GGG
[0082] In addition, a donor plasmid (Donor Vector) for homology repair was designed, which includes homology arms on both sides, exon 3 in the middle and two loxp sequences in the same direction.
[0083] ①Construction of targeting vector: The two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, and then ligated into pUC57-sgRNA vector treated with restriction endonuclease BsaI with T4 DNA ligase. There is a T7 promoter upstream of the vector, which can be used for subsequen...
Embodiment 3
[0104] [Example 3] Myocardial hypertrophy model acquisition
[0105] 1. Grouping of experimental animals: male background C57BL / 6 cardiac-specific Cre mice (α-MHC-Cre (WT), cardiac-specific ADAM23 knockout mice (ADAM23-KO) and cardiac-specific ADAM23 transgenic mice ( TG) and non-transgenic mice (NTG), established cardiac hypertrophy model by aortic coarctation. Randomly divided into 8 groups, grouped as follows: C57BL / 6 background wild-type mice sham operation group (WT Sham) and AB operation group (WT AB), ADAM23 knockout mouse sham operation group (ADAM23-KOSham) and AB operation group (ADAM23-KO AB), non-transgenic mouse sham operation group (NTG Sham) and AB operation group (NTG AB), Cardiac-specific ADAM23 transgenic mice sham operation group (TG Sham) and AB operation group (TG AB).
[0106] 2. The myocardial hypertrophy model adopts aortic arch coarctation (AB) surgery, and the operation process of the model is as follows:
[0107] 2.1 Preoperative preparation
[01...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


